After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Rat FTL cDNA 클론 제품 정보
Gene_bank_ref_id:BC061525.1
cDNA 크기:552bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus ferritin, light polypeptide with N terminal HA tag.
유전자 동의어:Ftl1
:Rat
벡터:pCMV3-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-HA 태그 on other vectors
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그RG80491-ACG265260
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그RG80491-ACR265260
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그RG80491-ANG265260
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그RG80491-ANR265260
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-Flag 태그RG80491-CF229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-His 태그RG80491-CH229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-Myc 태그RG80491-CM229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, C-HA 태그RG80491-CY229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-Flag 태그RG80491-NF229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-His 태그RG80491-NH229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-Myc 태그RG80491-NM229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmid, N-HA 태그RG80491-NY229890
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone in cloning vectorRG80491-U88420
쥐 FTL/ferritin, light polypeptide Gene ORF cDNA clone expression plasmidRG80491-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

참고자료
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Size / Price
    Cat No: RG80491-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".