쥐 GGT1 Gene ORF cDNA clone expression plasmid, C-HA 태그

    데이터시트리뷰관련제품프로토콜
     GGT1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_053840.2
    cDNA 크기:1707bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus gamma-glutamyltransferase 1 with C terminal HA tag.
    유전자 동의어:Ggt, Ggtp, GGLUT, RATGGLUT, Ggt1
    :Rat
    벡터:pCMV3-C-HA
    Plasmid:
    제한 사이트:
    태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GGT1 qPCR primers for gene expression analysis, RP300334 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    연구배경

    GGT1 belongs to the gamma-glutamyltransferase protein family. Many members of this family have not yet been fully characterized and some of which may represent pseudogenes. GGT1 is composed of a heavy chain and a light chain. It catalyzes the transfer of the glutamyl moiety of glutathione to a variety of amino acids and dipeptide acceptors. GGT1 also initiates extracellular glutathione (GSH) breakdown, provides cells with a local cysteine supply and contributes to maintain intracelular GSH level. As part of the cell antioxidant defense mechanism, GGT1 can be detected in fetal and adult kidney and liver, adult pancreas, stomach, intestine, placenta and lung. Defects in GGT1 can cause glutathionuria which is known as an autosomal recessive disease.

    참고자료
  • Bulle F, et al. (1987) Assignment of the human gamma-glutamyl transferase gene to the long arm of chromosome 22. Hum Genet. 76(3):283-6.
  • Tate SS, et al. (1988) Renal gamma-glutamyl transpeptidases: structural and immunological studies. Arch Biochem Biophys. 262(2):397-408.
  • Tate SS, et al. (1988) In vitro translation and processing of human hepatoma cell (Hep G2) gamma-glutamyl transpeptidase. Biochem Biophys Res Commun. 154(3):1167-73.
  • Size / Price
    Cat No: RG80364-CY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".