Glutaredoxin 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81101-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Glutaredoxin 1 Reagents
CRO Services
Product recommended

All Glutaredoxin 1 Reagents
Glutaredoxin 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
324 bp
Description
Full length Clone DNA of Rat glutaredoxin (thioltransferase) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Glutaredoxin 1 Background Information

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

Full Name
glutaredoxin
References
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Glutaredoxin 1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Glutaredoxin 1 cDNA ORF Clone in Cloning Vector, Rat RG81101-U
    Glutaredoxin 1 cDNA ORF Clone, Rat, untagged RG81101-UT
    Glutaredoxin 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81101-ACGLN
    Glutaredoxin 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81101-ACG
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81101-ANG
    Glutaredoxin 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81101-ACR
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81101-ANR
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81101-NF
    Glutaredoxin 1 cDNA ORF Clone, Rat, C-His tag RG81101-CH
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-His tag RG81101-NH
    Glutaredoxin 1 cDNA ORF Clone, Rat, C-HA tag RG81101-CY
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-HA tag RG81101-NY
    Glutaredoxin 1 cDNA ORF Clone, Rat, C-Myc tag RG81101-CM
    Glutaredoxin 1 cDNA ORF Clone, Rat, N-Myc tag RG81101-NM
    Glutaredoxin 1 qPCR Primer Pairs, Rat RP301058

    Glutaredoxin 1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Glutaredoxin 1 cDNA ORF Clone in Cloning Vector, Mouse MG52947-G
    Glutaredoxin 1 cDNA ORF Clone, Mouse, untagged MG52947-UT
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52947-ACG
    Glutaredoxin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52947-ACGLN
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52947-ANG
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52947-ACR
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52947-ANR
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52947-CF
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52947-NF
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-His tag MG52947-CH
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-His tag MG52947-NH
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-HA tag MG52947-CY
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-HA tag MG52947-NY
    Glutaredoxin 1 cDNA ORF Clone, Mouse, C-Myc tag MG52947-CM
    Glutaredoxin 1 cDNA ORF Clone, Mouse, N-Myc tag MG52947-NM

    Glutaredoxin 1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Glutaredoxin 1 cDNA ORF Clone in Cloning Vector, Human HG14484-G
    Glutaredoxin 1 cDNA ORF Clone, Human, untagged HG14484-UT
    Glutaredoxin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14484-ACGLN
    Glutaredoxin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14484-ACG
    Glutaredoxin 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14484-ANG
    Glutaredoxin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14484-ACR
    Glutaredoxin 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14484-ANR
    Glutaredoxin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14484-CF
    Glutaredoxin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14484-NF
    Glutaredoxin 1 cDNA ORF Clone, Human, C-His tag HG14484-CH
    Glutaredoxin 1 cDNA ORF Clone, Human, N-His tag HG14484-NH
    Glutaredoxin 1 cDNA ORF Clone, Human, C-HA tag HG14484-CY
    Glutaredoxin 1 cDNA ORF Clone, Human, N-HA tag HG14484-NY
    Glutaredoxin 1 cDNA ORF Clone, Human, C-Myc tag HG14484-CM
    Glutaredoxin 1 cDNA ORF Clone, Human, N-Myc tag HG14484-NM
    Glutaredoxin 1 qPCR Primer Pairs, Human HP103132
    info info
    添加购物车成功! 添加购物车失败!