GNG7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81612-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GNG7 Reagents
CRO Services
Product recommended

All GNG7 Reagents
GNG7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
210 bp
Description
Full length Clone DNA of Rat guanine nucleotide binding protein (G protein), gamma 7 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GNG7 Background Information
Full Name
guanine nucleotide binding protein (G protein), gamma 7

GNG7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GNG7 cDNA ORF Clone in Cloning Vector, Rat RG81612-G
GNG7 cDNA ORF Clone, Rat, untagged RG81612-UT
GNG7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81612-ACGLN
GNG7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81612-ACG
GNG7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81612-ANG
GNG7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81612-ACR
GNG7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81612-ANR
GNG7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81612-CF
GNG7 cDNA ORF Clone, Rat, C-His tag RG81612-CH
GNG7 cDNA ORF Clone, Rat, N-His tag RG81612-NH
GNG7 cDNA ORF Clone, Rat, C-HA tag RG81612-CY
GNG7 cDNA ORF Clone, Rat, N-HA tag RG81612-NY
GNG7 cDNA ORF Clone, Rat, C-Myc tag RG81612-CM
GNG7 cDNA ORF Clone, Rat, N-Myc tag RG81612-NM

GNG7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GNG7 cDNA ORF Clone in Cloning Vector, Human HG20874-U
GNG7 cDNA ORF Clone, Human, untagged HG20874-UT
GNG7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20874-ACGLN
GNG7 cDNA ORF Clone, Human, C-GFPSpark® tag HG20874-ACG
GNG7 cDNA ORF Clone, Human, N-GFPSpark® tag HG20874-ANG
GNG7 cDNA ORF Clone, Human, C-OFPSpark® tag HG20874-ACR
GNG7 cDNA ORF Clone, Human, N-OFPSpark® tag HG20874-ANR
GNG7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20874-CF
GNG7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20874-NF
GNG7 cDNA ORF Clone, Human, C-His tag HG20874-CH
GNG7 cDNA ORF Clone, Human, N-His tag HG20874-NH
GNG7 cDNA ORF Clone, Human, C-HA tag HG20874-CY
GNG7 cDNA ORF Clone, Human, N-HA tag HG20874-NY
GNG7 cDNA ORF Clone, Human, C-Myc tag HG20874-CM
GNG7 cDNA ORF Clone, Human, N-Myc tag HG20874-NM
info info
添加购物车成功! 添加购物车失败!