GSTA3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81116-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All GSTA3 Reagents
CRO Services
Product recommended

All GSTA3 Reagents
GSTA3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Rat glutathione S-transferase alpha 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTA3 Background Information
Full Name
glutathione S-transferase alpha 3

GSTA3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone in Cloning Vector, Rat RG81116-U
GSTA3 cDNA ORF Clone, Rat, untagged RG81116-UT
GSTA3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81116-ACGLN
GSTA3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81116-ACG
GSTA3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81116-ANG
GSTA3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81116-ACR
GSTA3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81116-ANR
GSTA3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81116-NF
GSTA3 cDNA ORF Clone, Rat, C-His tag RG81116-CH
GSTA3 cDNA ORF Clone, Rat, N-His tag RG81116-NH
GSTA3 cDNA ORF Clone, Rat, C-HA tag RG81116-CY
GSTA3 cDNA ORF Clone, Rat, N-HA tag RG81116-NY
GSTA3 cDNA ORF Clone, Rat, C-Myc tag RG81116-CM
GSTA3 cDNA ORF Clone, Rat, N-Myc tag RG81116-NM

GSTA3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone in Cloning Vector, Mouse MG53834-U
GSTA3 cDNA ORF Clone, Mouse, untagged MG53834-UT
GSTA3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53834-ACG
GSTA3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53834-ACGLN
GSTA3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53834-ANG
GSTA3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53834-ACR
GSTA3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53834-ANR
GSTA3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53834-CF
GSTA3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53834-NF
GSTA3 cDNA ORF Clone, Mouse, C-His tag MG53834-CH
GSTA3 cDNA ORF Clone, Mouse, N-His tag MG53834-NH
GSTA3 cDNA ORF Clone, Mouse, C-HA tag MG53834-CY
GSTA3 cDNA ORF Clone, Mouse, N-HA tag MG53834-NY
GSTA3 cDNA ORF Clone, Mouse, C-Myc tag MG53834-CM
GSTA3 cDNA ORF Clone, Mouse, N-Myc tag MG53834-NM

GSTA3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone, Human, untagged HG20571-UT
info info
添加购物车成功! 添加购物车失败!