GSTA3 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81116-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GSTA3 Reagents

CRO Services

Product recommended


All GSTA3 Reagents

GSTA3 cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
666 bp
Description
Full length Clone DNA of Rat glutathione S-transferase alpha 3 with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTA3 Background Information

Full Name
glutathione S-transferase alpha 3

GSTA3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone in Cloning Vector, Rat RG81116-U
GSTA3 cDNA ORF Clone, Rat, untagged RG81116-UT
GSTA3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81116-ACG
GSTA3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81116-ACGLN
GSTA3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81116-ANG
GSTA3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81116-ACR
GSTA3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81116-ANR
GSTA3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81116-CF
GSTA3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81116-NF
GSTA3 cDNA ORF Clone, Rat, C-His tag RG81116-CH
GSTA3 cDNA ORF Clone, Rat, N-His tag RG81116-NH
GSTA3 cDNA ORF Clone, Rat, C-HA tag RG81116-CY
GSTA3 cDNA ORF Clone, Rat, N-HA tag RG81116-NY
GSTA3 cDNA ORF Clone, Rat, N-Myc tag RG81116-NM

GSTA3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone in Cloning Vector, Mouse MG53834-U
GSTA3 cDNA ORF Clone, Mouse, untagged MG53834-UT
GSTA3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53834-ACGLN
GSTA3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53834-ACG
GSTA3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53834-ANG
GSTA3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53834-ACR
GSTA3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53834-ANR
GSTA3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53834-CF
GSTA3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53834-NF
GSTA3 cDNA ORF Clone, Mouse, C-His tag MG53834-CH
GSTA3 cDNA ORF Clone, Mouse, N-His tag MG53834-NH
GSTA3 cDNA ORF Clone, Mouse, C-HA tag MG53834-CY
GSTA3 cDNA ORF Clone, Mouse, N-HA tag MG53834-NY
GSTA3 cDNA ORF Clone, Mouse, C-Myc tag MG53834-CM
GSTA3 cDNA ORF Clone, Mouse, N-Myc tag MG53834-NM

GSTA3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GSTA3 cDNA ORF Clone, Human, untagged HG20571-UT
info info
添加购物车成功! 添加购物车失败!