GSTM7 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80707-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GSTM7 Reagents

CRO Services

Product recommended


All GSTM7 Reagents

GSTM7 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Rat glutathione S-transferase, mu 7 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GSTM7 Background Information

Full Name
glutathione S-transferase, mu 7

GSTM7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GSTM7 cDNA ORF Clone in Cloning Vector, Rat RG80707-U
GSTM7 cDNA ORF Clone, Rat, untagged RG80707-UT
GSTM7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80707-ACGLN
GSTM7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80707-ACG
GSTM7 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80707-ANG
GSTM7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80707-ACR
GSTM7 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80707-ANR
GSTM7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80707-CF
GSTM7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80707-NF
GSTM7 cDNA ORF Clone, Rat, C-His tag RG80707-CH
GSTM7 cDNA ORF Clone, Rat, N-His tag RG80707-NH
GSTM7 cDNA ORF Clone, Rat, C-HA tag RG80707-CY
GSTM7 cDNA ORF Clone, Rat, N-HA tag RG80707-NY
GSTM7 cDNA ORF Clone, Rat, C-Myc tag RG80707-CM
GSTM7 qPCR Primer Pairs, Rat RP300671

GSTM7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GSTM7 cDNA ORF Clone in Cloning Vector, Mouse MG53090-G
GSTM7 cDNA ORF Clone, Mouse, untagged MG53090-UT
GSTM7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53090-ACGLN
GSTM7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53090-ACG
GSTM7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53090-ANG
GSTM7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53090-ACR
GSTM7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53090-ANR
GSTM7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53090-CF
GSTM7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53090-NF
GSTM7 cDNA ORF Clone, Mouse, C-His tag MG53090-CH
GSTM7 cDNA ORF Clone, Mouse, N-His tag MG53090-NH
GSTM7 cDNA ORF Clone, Mouse, C-HA tag MG53090-CY
GSTM7 cDNA ORF Clone, Mouse, N-HA tag MG53090-NY
GSTM7 cDNA ORF Clone, Mouse, C-Myc tag MG53090-CM
GSTM7 cDNA ORF Clone, Mouse, N-Myc tag MG53090-NM
info info
添加购物车成功! 添加购物车失败!