HBA2 cDNA ORF Clone, Rat, untagged

Cat: RG81053-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All HBA2 Reagents
CRO Services
Product recommended

All HBA2 Reagents
HBA2 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
429 bp
Description
Full length Clone DNA of Rat hemoglobin, alpha 2.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

HBA2 Background Information
Full Name
hemoglobin subunit alpha 2

HBA2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
HBA2 cDNA ORF Clone in Cloning Vector, Rat RG81053-U
HBA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81053-ACGLN
HBA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81053-ACG
HBA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81053-ANG
HBA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81053-ACR
HBA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81053-ANR
HBA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81053-CF
HBA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81053-NF
HBA2 cDNA ORF Clone, Rat, C-His tag RG81053-CH
HBA2 cDNA ORF Clone, Rat, N-His tag RG81053-NH
HBA2 cDNA ORF Clone, Rat, C-HA tag RG81053-CY
HBA2 cDNA ORF Clone, Rat, N-HA tag RG81053-NY
HBA2 cDNA ORF Clone, Rat, C-Myc tag RG81053-CM
HBA2 cDNA ORF Clone, Rat, N-Myc tag RG81053-NM
HBA2 qPCR Primer Pairs, Rat RP301017

HBA2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
HBA2 cDNA ORF Clone in Cloning Vector, Human HG16903-U
HBA2 cDNA ORF Clone, Human, untagged HG16903-UT
HBA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16903-ACG
HBA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16903-ACGLN
HBA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16903-ANG
HBA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16903-ACR
HBA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16903-ANR
HBA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16903-CF
HBA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16903-NF
HBA2 cDNA ORF Clone, Human, C-His tag HG16903-CH
HBA2 cDNA ORF Clone, Human, N-His tag HG16903-NH
HBA2 cDNA ORF Clone, Human, C-HA tag HG16903-CY
HBA2 cDNA ORF Clone, Human, N-HA tag HG16903-NY
HBA2 cDNA ORF Clone, Human, C-Myc tag HG16903-CM
HBA2 cDNA ORF Clone, Human, N-Myc tag HG16903-NM
info info
添加购物车成功! 添加购物车失败!