쥐 IL13/IL-13/ALRH Gene ORF cDNA clone expression plasmid, N-HA 태그

  • Rhesus CD3d/CD3 delta Gene Plasmid Map 5616
데이터시트리뷰관련제품프로토콜
 IL13 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_053828.1
cDNA 크기:423 bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus interleukin 13 with N terminal HA tag.
유전자 동의어:IL13
:Rat
벡터:pCMV3-SP-N-HA
Plasmid:pCMV3-SP-HA-ratIL13
제한 사이트:KpnI + XbaI(6kb+0.42kb)
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL13 qPCR primers for gene expression analysis, RP300425 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

참고자료
  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • Size / Price
    Cat No: RG80460-NY
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".