IL17 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80461-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All IL17 Reagents

CRO Services

Product recommended


All IL17 Reagents

IL17 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
477 bp
Description
Full length Clone DNA of Rat interleukin 17A with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL17 Background Information

IL17, also known as IL17a, is a cytokine belongs to the IL-17 family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. The IL-17 family of cytokines includes six members, IL-17/IL-17A, IL-17B, IL-17C, IL-17D, IL-17E/IL-25, and IL-17F, which are produced by multiple cell types. IL-17 regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of IL-17 are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interleukin 17A
References
  • Andoh A, et al. (2002) IL-17 selectively down-regulates TNF-alpha-induced RANTES gene expression in human colonic subepithelial myofibroblasts. J Immunol. 169(4):1683-7.
  • Kotake S, et al. (1999) IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. J Clin Invest. 103(9):1345-52.
  • Laan M, et al. (1999) Neutrophil recruitment by human IL-17 via C-X-C chemokine release in the airways. J Immunol. 162(4):2347-52.
  • Shin HC, et al. (1999) Regulation of IL-17, IFN-gamma and IL-10 in human CD8(+) T cells by cyclic AMP-dependent signal transduction pathway. Cytokine. 10(11):841-50.
  • IL17 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Rhesus KG90306-G
    IL17 cDNA ORF Clone, Rhesus, untagged KG90306-UT
    IL17 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag KG90306-ACGLN
    IL17 cDNA ORF Clone, Rhesus, C-GFPSpark® tag KG90306-ACG
    IL17 cDNA ORF Clone, Rhesus, C-OFPSpark® tag KG90306-ACR
    IL17 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag KG90306-CF
    IL17 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag KG90306-NF
    IL17 cDNA ORF Clone, Rhesus, C-His tag KG90306-CH
    IL17 cDNA ORF Clone, Rhesus, N-His tag KG90306-NH
    IL17 cDNA ORF Clone, Rhesus, C-HA tag KG90306-CY
    IL17 cDNA ORF Clone, Rhesus, N-HA tag KG90306-NY
    IL17 cDNA ORF Clone, Rhesus, C-Myc tag KG90306-CM
    IL17 cDNA ORF Clone, Rhesus, N-Myc tag KG90306-NM

    IL17 cDNA ORF Clone, Marmoset, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Marmoset CG90287-G
    IL17 cDNA ORF Clone, Marmoset, untagged CG90287-UT
    IL17 Lentiviral cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90287-ACGLN
    IL17 cDNA ORF Clone, Marmoset, C-GFPSpark® tag CG90287-ACG
    IL17 cDNA ORF Clone, Marmoset, C-OFPSpark® tag CG90287-ACR
    IL17 cDNA ORF Clone, Marmoset, C-DDK (Flag®) tag CG90287-CF
    IL17 cDNA ORF Clone, Marmoset, N-DDK (Flag®) tag CG90287-NF
    IL17 cDNA ORF Clone, Marmoset, C-His tag CG90287-CH
    IL17 cDNA ORF Clone, Marmoset, N-His tag CG90287-NH
    IL17 cDNA ORF Clone, Marmoset, C-HA tag CG90287-CY
    IL17 cDNA ORF Clone, Marmoset, N-HA tag CG90287-NY
    IL17 cDNA ORF Clone, Marmoset, C-Myc tag CG90287-CM
    IL17 cDNA ORF Clone, Marmoset, N-Myc tag CG90287-NM

    IL17 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Canine DG70102-G

    IL17 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    IL17 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90880-ACGLN
    IL17 cDNA ORF Clone, Cynomolgus, C-His tag CG90880-CH

    IL17 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Rabbit TG65006-G
    IL17 cDNA ORF Clone, Rabbit, untagged TG65006-UT
    IL17 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65006-ACG
    IL17 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65006-ACGLN
    IL17 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65006-ACR
    IL17 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65006-CF
    IL17 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65006-NF
    IL17 cDNA ORF Clone, Rabbit, C-His tag TG65006-CH
    IL17 cDNA ORF Clone, Rabbit, N-His tag TG65006-NH
    IL17 cDNA ORF Clone, Rabbit, C-HA tag TG65006-CY
    IL17 cDNA ORF Clone, Rabbit, N-HA tag TG65006-NY
    IL17 cDNA ORF Clone, Rabbit, C-Myc tag TG65006-CM
    IL17 cDNA ORF Clone, Rabbit, N-Myc tag TG65006-NM

    IL17 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Rat RG80461-G
    IL17 cDNA ORF Clone, Rat, untagged RG80461-UT
    IL17 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80461-ACGLN
    IL17 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80461-ACG
    IL17 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80461-ACR
    IL17 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80461-CF
    IL17 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80461-NF
    IL17 cDNA ORF Clone, Rat, C-His tag RG80461-CH
    IL17 cDNA ORF Clone, Rat, N-His tag RG80461-NH
    IL17 cDNA ORF Clone, Rat, C-HA tag RG80461-CY
    IL17 cDNA ORF Clone, Rat, C-Myc tag RG80461-CM
    IL17 cDNA ORF Clone, Rat, N-Myc tag RG80461-NM
    IL17 qPCR Primer Pairs, Rat RP300426

    IL17 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Mouse MG51065-G
    IL17 cDNA ORF Clone, Mouse, untagged MG51065-UT
    IL17 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51065-ACG
    IL17 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51065-ACGLN
    IL17 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51065-ACR
    IL17 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51065-CF
    IL17 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51065-NF
    IL17 cDNA ORF Clone, Mouse, C-His tag MG51065-CH
    IL17 cDNA ORF Clone, Mouse, N-His tag MG51065-NH
    IL17 cDNA ORF Clone, Mouse, C-HA tag MG51065-CY
    IL17 cDNA ORF Clone, Mouse, N-HA tag MG51065-NY
    IL17 cDNA ORF Clone, Mouse, C-Myc tag MG51065-CM
    IL17 cDNA ORF Clone, Mouse, N-Myc tag MG51065-NM
    IL17 qPCR Primer Pairs, Mouse MP201021

    IL17 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL17 cDNA ORF Clone in Cloning Vector, Human HG12047-G
    IL17 cDNA ORF Clone, Human, untagged HG12047-UT
    IL17 cDNA ORF Clone, Human, C-GFPSpark® tag HG12047-ACG
    IL17 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12047-ACGLN
    IL17 cDNA ORF Clone, Human, C-OFPSpark® tag HG12047-ACR
    IL17 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12047-CF
    IL17 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12047-NF
    IL17 cDNA ORF Clone, Human, C-His tag HG12047-CH
    IL17 cDNA ORF Clone, Human, N-His tag HG12047-NH
    IL17 cDNA ORF Clone, Human, C-HA tag HG12047-CY
    IL17 cDNA ORF Clone, Human, N-HA tag HG12047-NY
    IL17 cDNA ORF Clone, Human, C-Myc tag HG12047-CM
    IL17 cDNA ORF Clone, Human, N-Myc tag HG12047-NM
    IL17 qPCR Primer Pairs, Human HP101581
    info info
    添加购物车成功! 添加购物车失败!