After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 IL-24/MDA-7 Gene ORF cDNA clone expression plasmid, N-HA 태그

데이터시트리뷰관련제품프로토콜
Rat IL24 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_133311.1
cDNA 크기:551bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus interleukin 24 with N terminal HA tag.
유전자 동의어:Mda7, Mda-7
:Rat
벡터:pCMV3-SP-N-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Interleukin-24 (IL-24) also known as Melanoma differentiation-associated gene 7 protein (MDA-7) is a member of the IL10 family of cytokines. IL-24/MDA-7/IL24 can induce apoptosis selectively in various cancer cells. Overexpression of IL-24 leads to elevated expression of several GADD family genes, which correlates with the induction of apoptosis. The phosphorylation of mitogen-activated protein kinase 14 (MAPK7/P38), and heat shock 27kDa protein 1 (HSPB2/HSP27) are found to be induced by this gene in melanoma cells, but not in normal immortal melanocytes. Human IL-24/MDA-7/IL24 is secreted by activated peripheral blood mononuclear cells and is the ligand for two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. Northern blot analysis revealed IL-24/MDA-7/IL24 expression in human tissues associated with the immune system such as spleen, thymus, peripheral blood leukocytes and normal melanocytes. IL-24/MDA-7/IL24 binding to either its endogenous receptors on human keratinocytes or to ectopically expressed receptors on baby hamster kidney cells leads to activation of the signal transducers and activators of transcription.

참고자료
  • Wang M, et al.. (2002) Interleukin 24 (MDA-7/MOB-5) signals through two heterodimeric receptors, IL-22R1/IL-20R2 and IL-20R1/IL-20R2. J Biol Chem. 277(9): 7341-7.
  • Sauane M, et al.. (2003) MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev. 14(1): 35-51.
  • Sarkar D, et al.. (2002) mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A. 99(15): 10054-9.
  • Size / Price
    Cat No: RG80464-NY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".