IL4R cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG80198-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL4R Reagents
CRO Services
Product recommended

All IL4R Reagents
IL4R cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2406 bp
Description
Full length Clone DNA of Rat interleukin 4 receptor, alpha with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL4R cDNA ORF Clone, Rat, N-DDK (Flag®) tag Alternative Names
IL4R cDNA ORF Clone, Rat;Il4ra cDNA ORF Clone, Rat
IL4R Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD124, also known as interleukin 4 receptor (IL4R), is a typeⅠ transmembrane protein that can regulate IgE antibody production in B cells through binding to interleukin 4 and interleukin 13 and promote differentiation of Th2 cells through binding to interleukin 4. The membrane-bound form of CD124 can be hydrolyzed to soluble form which can inhibit IL4-mediated cell proliferation and IL5 upregulation by T-cells.

Full Name
interleukin 4 receptor
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • info info
    添加购物车成功! 添加购物车失败!