Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-His tag

Cat: RG80291-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Integrin alpha 4/CD49d/ITGA4 Reagents
CRO Services
Product recommended

All Integrin alpha 4/CD49d/ITGA4 Reagents
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3111 bp
Description
Full length Clone DNA of Rat integrin, alpha 4 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 4/CD49d/ITGA4 Background Information
Full Name
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Research Areas

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Rhesus CG90193-G
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, untagged CG90193-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90193-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90193-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90193-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90193-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90193-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-His tag CG90193-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-His tag CG90193-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-HA tag CG90193-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-HA tag CG90193-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-Myc tag CG90193-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-Myc tag CG90193-NM

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Rat RG80291-G
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, untagged RG80291-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80291-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80291-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80291-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80291-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80291-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-His tag RG80291-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-HA tag RG80291-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-HA tag RG80291-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-Myc tag RG80291-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-Myc tag RG80291-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Rat RP300268

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Mouse MG50049-M
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, untagged MG50049-UT
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50049-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50049-ACG
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50049-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50049-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50049-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-His tag MG50049-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-His tag MG50049-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-HA tag MG50049-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-HA tag MG50049-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-Myc tag MG50049-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-Myc tag MG50049-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Mouse MP200049

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Human HG12121-M
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged HG12121-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12121-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11849-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12121-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12121-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12121-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-His tag HG12121-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-His tag HG12121-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-HA tag HG12121-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-HA tag HG12121-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-Myc tag HG12121-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-Myc tag HG12121-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Human HP101648
info info
添加购物车成功! 添加购物车失败!