ITGA6 cDNA ORF Clone, Rat, N-His tag

Cat: RG80292-NH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All ITGA6 Reagents

CRO Services

Product recommended


All ITGA6 Reagents

ITGA6 cDNA ORF Clone, Rat, N-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3273 bp
Description
Full length Clone DNA of Rat integrin, alpha 6 with N terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITGA6 Background Information

Full Name
integrin, alpha 6

ITGA6 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
ITGA6 cDNA ORF Clone in Cloning Vector, Rhesus CG90198-G
ITGA6 cDNA ORF Clone, Rhesus, untagged CG90198-UT
ITGA6 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90198-ACG
ITGA6 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90198-ACGLN
ITGA6 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90198-ACR
ITGA6 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90198-CF
ITGA6 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90198-NF
ITGA6 cDNA ORF Clone, Rhesus, C-His tag CG90198-CH
ITGA6 cDNA ORF Clone, Rhesus, N-His tag CG90198-NH
ITGA6 cDNA ORF Clone, Rhesus, C-HA tag CG90198-CY
ITGA6 cDNA ORF Clone, Rhesus, N-HA tag CG90198-NY
ITGA6 cDNA ORF Clone, Rhesus, C-Myc tag CG90198-CM
ITGA6 cDNA ORF Clone, Rhesus, N-Myc tag CG90198-NM

ITGA6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITGA6 cDNA ORF Clone in Cloning Vector, Rat RG80292-G
ITGA6 cDNA ORF Clone, Rat, untagged RG80292-UT
ITGA6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80292-ACGLN
ITGA6 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80292-ACG
ITGA6 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80292-ACR
ITGA6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80292-CF
ITGA6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80292-NF
ITGA6 cDNA ORF Clone, Rat, C-His tag RG80292-CH
ITGA6 cDNA ORF Clone, Rat, C-HA tag RG80292-CY
ITGA6 cDNA ORF Clone, Rat, N-HA tag RG80292-NY
ITGA6 cDNA ORF Clone, Rat, C-Myc tag RG80292-CM
ITGA6 cDNA ORF Clone, Rat, N-Myc tag RG80292-NM
ITGA6 qPCR Primer Pairs, Rat RP300269

ITGA6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITGA6 cDNA ORF Clone in Cloning Vector, Human HG13016-M
ITGA6 cDNA ORF Clone, Human, untagged HG13016-UT
ITGA6 cDNA ORF Clone, Human, C-GFPSpark® tag HG13016-ACG
ITGA6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13016-ACGLN
ITGA6 cDNA ORF Clone, Human, C-OFPSpark® tag HG13016-ACR
ITGA6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13016-CF
ITGA6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13016-NF
ITGA6 cDNA ORF Clone, Human, C-His tag HG13016-CH
ITGA6 cDNA ORF Clone, Human, N-His tag HG13016-NH
ITGA6 cDNA ORF Clone, Human, C-HA tag HG13016-CY
ITGA6 cDNA ORF Clone, Human, N-HA tag HG13016-NY
ITGA6 cDNA ORF Clone, Human, C-Myc tag HG13016-CM
ITGA6 cDNA ORF Clone, Human, N-Myc tag HG13016-NM
ITGA6 qPCR Primer Pairs, Human HP101676
info info
添加购物车成功! 添加购物车失败!