LFA-1 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80435-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LFA-1 Reagents

CRO Services

Product recommended


All LFA-1 Reagents

LFA-1 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3483 bp
Description
Full length Clone DNA of Rat integrin, alpha L with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LFA-1 Background Information

Full Name
integrin subunit alpha L

LFA-1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LFA-1 cDNA ORF Clone in Cloning Vector, Rat RG80435-G
LFA-1 cDNA ORF Clone, Rat, untagged RG80435-UT
LFA-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80435-ACGLN
LFA-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80435-ACG
LFA-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80435-ACR
LFA-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80435-CF
LFA-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80435-NF
LFA-1 cDNA ORF Clone, Rat, C-His tag RG80435-CH
LFA-1 cDNA ORF Clone, Rat, N-His tag RG80435-NH
LFA-1 cDNA ORF Clone, Rat, C-HA tag RG80435-CY
LFA-1 cDNA ORF Clone, Rat, C-Myc tag RG80435-CM
LFA-1 cDNA ORF Clone, Rat, N-Myc tag RG80435-NM
LFA-1 qPCR Primer Pairs, Rat RP300407

LFA-1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LFA-1 cDNA ORF Clone in Cloning Vector, Human HG10812-M
LFA-1 cDNA ORF Clone, Human, untagged HG10812-UT
LFA-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10812-ACGLN
LFA-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10812-ACG
LFA-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10812-ACR
LFA-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10812-CF
LFA-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10812-NF
LFA-1 cDNA ORF Clone, Human, C-His tag HG10812-CH
LFA-1 cDNA ORF Clone, Human, N-His tag HG10812-NH
LFA-1 cDNA ORF Clone, Human, C-HA tag HG10812-CY
LFA-1 cDNA ORF Clone, Human, N-HA tag HG10812-NY
LFA-1 cDNA ORF Clone, Human, C-Myc tag HG10812-CM
LFA-1 cDNA ORF Clone, Human, N-Myc tag HG10812-NM
LFA-1 qPCR Primer Pairs, Human HP100915
info info
添加购物车成功! 添加购物车失败!