쥐 CD61/Integrin beta 3/ITGB3 Gene ORF cDNA clone expression plasmid, C-His 태그

  • Rat CD61/Integrin beta 3/ITGB3 Gene Plasmid Map 17379
데이터시트리뷰관련제품프로토콜
 ITGB3 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_153720.1
cDNA 크기:2409 bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with C terminal His tag.
유전자 동의어:Itgb3
:Rat
벡터:pCMV3-C-His
Plasmid:pCMV3-ratITGB3-His
제한 사이트:KpnI(two restriction sites) + XbaI(6kb+1.94kb+0.48)
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB3 qPCR primers for gene expression analysis, RP300285 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Cat No: RG80312-CH
정가: 
가격:      (You Save: )
크기:
수량:+-
재고정보In Stock
장바구니에 추가대량 주문 문의

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".