After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 IZUMO4 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat IZUMO4 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_002726872.3
cDNA 크기:684bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus IZUMO family member 4 with N terminal Flag tag.
유전자 동의어:RGD1564722
:Rat
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Izumo is a sperm membrane protein which plays a key role in the fusion in the mouse. It has an Immunoglobulin (Ig) domain and an N-terminal domain for which neither the functions nor homologous sequences are known. Up to now, there four members has an N-terminal domain with significant homology to the N-terminal domain of Izumo. We call this domain Izumo domain. The four proteins are Izumo 1, 2, 3, and 4. Izumo domain possesses the ability to form dimers, whereas the transmembrane domain or the cytoplasmic domain or both of Izumo 1 are required for the formation of multimers of higher order. Izumo 1-3 are transmembrane proteins expressed specifically in the testis, and Izumo 4 is a soluble protein expressed in the testis and in other tissues. Izumo 1, 3, and 4 formed protein complexes on sperm, Izumo 1 forming several larger complexes and Izumo 3 and 4 forming a single larger complex. Co-immunoprecipitation studies showed the presence of other sperm proteins associated with Izumo 1, suggesting Izumo 1 forms a multiprotein membrane complex.

참고자료
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Lamesch P, et al. (2007) hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes. Genomics. 89(3):307-15.
  • Ellerman DA, et al. (2009) Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol Reprod Dev. 76(12):1188-99.
  • Size / Price
    Cat No: RG81606-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".