KNG2 cDNA ORF Clone, Rat, C-His tag

Cat: RG81650-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All KNG2 Reagents

CRO Services

Product recommended


All KNG2 Reagents

KNG2 cDNA ORF Clone, Rat, C-His tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1920 bp
Description
Full length Clone DNA of Rat kininogen 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KNG2 Background Information

Full Name
kininogen 2

KNG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
KNG2 cDNA ORF Clone in Cloning Vector, Rat RG81650-G
KNG2 cDNA ORF Clone, Rat, untagged RG81650-UT
KNG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81650-ACGLN
KNG2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81650-ACG
KNG2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81650-ACR
KNG2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81650-CF
KNG2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81650-NF
KNG2 cDNA ORF Clone, Rat, N-His tag RG81650-NH
KNG2 cDNA ORF Clone, Rat, C-HA tag RG81650-CY
KNG2 cDNA ORF Clone, Rat, N-HA tag RG81650-NY
KNG2 cDNA ORF Clone, Rat, C-Myc tag RG81650-CM
KNG2 cDNA ORF Clone, Rat, N-Myc tag RG81650-NM

KNG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KNG2 cDNA ORF Clone in Cloning Vector, Mouse MG52865-G
KNG2 cDNA ORF Clone, Mouse, untagged MG52865-UT
KNG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52865-ACG
KNG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52865-ACGLN
KNG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52865-ANG
KNG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52865-ACR
KNG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52865-ANR
KNG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52865-CF
KNG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52865-NF
KNG2 cDNA ORF Clone, Mouse, C-His tag MG52865-CH
KNG2 cDNA ORF Clone, Mouse, N-His tag MG52865-NH
KNG2 cDNA ORF Clone, Mouse, C-HA tag MG52865-CY
KNG2 cDNA ORF Clone, Mouse, N-HA tag MG52865-NY
KNG2 cDNA ORF Clone, Mouse, C-Myc tag MG52865-CM
KNG2 cDNA ORF Clone, Mouse, N-Myc tag MG52865-NM
info info
添加购物车成功! 添加购物车失败!