After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 LIFR/CD118 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Rat LIFR cDNA 클론 제품 정보
Gene_bank_ref_id:NM_031048.1
cDNA 크기:3282bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus leukemia inhibitory factor receptor alpha with C terminal HA tag.
유전자 동의어:Lifr
:Rat
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

참고자료
  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • Size / Price
    Cat No: RG80322-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".