LIFR cDNA ORF Clone, Rat, C-HA tag

Cat: RG80322-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All LIFR Reagents

CRO Services

Product recommended


All LIFR Reagents

LIFR cDNA ORF Clone, Rat, C-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3282 bp
Description
Full length Clone DNA of Rat leukemia inhibitory factor receptor alpha with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIFR Background Information

LIFR (leukemia inhibitory factor receptor) belongs to the family of cytokine receptors. LIFR forms a high-affinity receptor complex with gp130, which mediates the activity of LIF (leukemia inhibitory factor) and thus affects the differentiation, proliferation, and survival of a wide variety of cells in the adult and the embryo. Besides LIF, LIFR can also bind to and activate CNTF (ciliary neurotrophic factor) and CLC (cardiotrophin like cytokine). Evidence showed that in the retina, LIFR activating LIF, CT-1 and cardiotrophin like cytokine (CLC) are strongly upregulated in response to preconditioning with bright cyclic light leading to robust activation of signal transducer and activator of transcription-3 (STAT3) in a time-dependent manner. Further, blocking LIFR activation during preconditioning using a LIFR antagonist (LIF05) attenuated the induced STAT3 activation and also resulted in reduced preconditioning-induced protection of the retinal photoreceptors. These data demonstrate that LIFR and its ligands play an essential role in endogenous neuroprotective mechanisms triggered by preconditioning-induced stress. LIFR was newly found to be a suppressor of hepatocellular carcinoma (HCC), one of the world's top five causes of cancer-related deaths.

Full Name
leukemia inhibitory factor receptor alpha
References
  • Gearing, D.P. et al.,1991, EMBO J. 10 (10): 2839-2848.
  • Gearing, D.P. et al.,1992, New Biol. 4 (1): 61-65.
  • Mosley, B. et al.,1996, J. Biol. Chem. 271 (51): 32635-32643.
  • Timmermann, A. et al.,2002, Eur. J. Biochem. 269 (11): 2716-2726.
  • Lass, A. et al.,2002, Fertil. Steril. 76 (6): 1091-1096.
  • LIFR cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    LIFR cDNA ORF Clone in Cloning Vector, Rhesus CG90210-G
    LIFR cDNA ORF Clone, Rhesus, untagged CG90210-UT
    LIFR cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90210-ACG
    LIFR Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90210-ACGLN
    LIFR cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90210-ACR
    LIFR cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90210-CF
    LIFR cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90210-NF
    LIFR cDNA ORF Clone, Rhesus, C-His tag CG90210-CH
    LIFR cDNA ORF Clone, Rhesus, N-His tag CG90210-NH
    LIFR cDNA ORF Clone, Rhesus, C-HA tag CG90210-CY
    LIFR cDNA ORF Clone, Rhesus, N-HA tag CG90210-NY
    LIFR cDNA ORF Clone, Rhesus, C-Myc tag CG90210-CM
    LIFR cDNA ORF Clone, Rhesus, N-Myc tag CG90210-NM

    LIFR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LIFR cDNA ORF Clone in Cloning Vector, Rat RG80322-G
    LIFR cDNA ORF Clone, Rat, untagged RG80322-UT
    LIFR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80322-ACGLN
    LIFR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80322-ACG
    LIFR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80322-ACR
    LIFR cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80322-CF
    LIFR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80322-NF
    LIFR cDNA ORF Clone, Rat, C-His tag RG80322-CH
    LIFR cDNA ORF Clone, Rat, N-His tag RG80322-NH
    LIFR cDNA ORF Clone, Rat, N-HA tag RG80322-NY
    LIFR cDNA ORF Clone, Rat, C-Myc tag RG80322-CM
    LIFR cDNA ORF Clone, Rat, N-Myc tag RG80322-NM
    LIFR qPCR Primer Pairs, Rat RP300293

    LIFR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LIFR cDNA ORF Clone in Cloning Vector, Mouse MG50423-M
    LIFR cDNA ORF Clone, Mouse, untagged MG50423-UT
    LIFR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50423-ACGLN
    LIFR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50423-ACG
    LIFR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50423-ACR
    LIFR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50423-CF
    LIFR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50423-NF
    LIFR cDNA ORF Clone, Mouse, C-His tag MG50423-CH
    LIFR cDNA ORF Clone, Mouse, N-His tag MG50423-NH
    LIFR cDNA ORF Clone, Mouse, C-HA tag MG50423-CY
    LIFR cDNA ORF Clone, Mouse, N-HA tag MG50423-NY
    LIFR cDNA ORF Clone, Mouse, C-Myc tag MG50423-CM
    LIFR cDNA ORF Clone, Mouse, N-Myc tag MG50423-NM
    LIFR qPCR Primer Pairs, Mouse MP200088

    LIFR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LIFR cDNA ORF Clone in Cloning Vector, Human HG10628-M
    LIFR cDNA ORF Clone, Human, untagged HG10628-UT
    LIFR cDNA ORF Clone, Human, C-GFPSpark® tag HG10628-ACG
    LIFR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10628-ACGLN
    LIFR cDNA ORF Clone, Human, C-OFPSpark® tag HG10628-ACR
    LIFR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10628-CF
    LIFR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10628-NF
    LIFR cDNA ORF Clone, Human, C-His tag HG10628-CH
    LIFR cDNA ORF Clone, Human, N-His tag HG10628-NH
    LIFR cDNA ORF Clone, Human, C-HA tag HG10628-CY
    LIFR cDNA ORF Clone, Human, N-HA tag HG10628-NY
    LIFR cDNA ORF Clone, Human, C-Myc tag HG10628-CM
    LIFR cDNA ORF Clone, Human, N-Myc tag HG10628-NM
    LIFR qPCR Primer Pairs, Human HP100868
    info info
    添加购物车成功! 添加购物车失败!