쥐 LMAN2 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
     LMAN2 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_001115024.2
    cDNA 크기:1077bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus lectin, mannose-binding 2.
    유전자 동의어:Vip36
    :Rat
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LMAN2 qPCR primers for gene expression analysis, RP300986 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    참고자료
  • Nawa D, et al. (2007) Stable interaction of the cargo receptor VIP36 with molecular chaperone BiP. Glycobiology. 17(9): 913-21.
  • Shimada O, et al. (2003) Localization of VIP36 in the post-Golgi secretory pathway also of rat parotid acinar cells. J Histochem Cytochem. 51(8): 1057-63.
  • Hara-Kuge S, et al. (1999) Vesicular-integral membrane protein, VIP36, recognizes high-mannose type glycans containing alpha1--2 mannosyl residues in MDCK cells. Glycobiology. 9(8): 833-9.
  • Fullekrug J, et al. (1999) VIP36 localisation to the early secretory pathway. J Cell Sci. 112 ( Pt 17): 2813-21.
  • Size / Price
    Cat No: RG81022-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
      최근에 조회한 품목
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".