쥐 MBL-1 Gene ORF cDNA clone expression plasmid

    데이터시트리뷰관련제품프로토콜
     MBL1 cDNA 클론 제품 정보
    Gene_bank_ref_id:NM_012599.2
    cDNA 크기:717bp
    cDNA 설명:Full length Clone DNA of Rattus norvegicus mannose-binding lectin (protein A) 1.
    유전자 동의어:Mbpa, Mlb1, Mbl1
    :Rat
    벡터:pCMV3-untagged
    Plasmid:
    제한 사이트:
    태그 씨퀀스:
    염기서열 설명:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MBL1 qPCR primers for gene expression analysis, RP300236 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    보관:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    연구배경

    Mannose-binding lectin (MBL), also named mannose or mannan-binding protein (MBP), is a C-type lectin which participates in the innate immune system as an activator of the complement system and as opsonin after binding to certain carbohydrate structures on microorganisms and pathogens. Its function appears to be pattern recognition in the first line of defense in the pre-immune host. MBL recognizes carbohydrate patterns found on the surface of a large number of pathogenic micro-organisms including bacteria, viruses, protozoa and fungi. Binding of MBL to a micro-organism results in activation of the lectin pathway of the complement system. Two forms of MBL, MBL-A and MBL-C, were characterized in rodents, rabbits, bovine and rhesus monkeys, whereas only one form was identified in humans, chimpanzees and chickens. The two forms are encoded by two distinct genes named MBL1 and MBL2, which have been identified in many species including the pig. The MBL1 and MBL2 genes encode mannan-binding lectins (MBL) A and C, respectively, that are collagenous lectins (collectins) produced mainly by the liver. The MBL1 gene encodes MBL-A, which has bacteria-binding properties in pigs and rodents but is mutated to a pseudogene in humans and chimpanzees. Deficiency of MBL is probably the most common human immunodeficiency and is associated with an increased risk of mucosally acquired infections including meningococcal disease. MBL could modify disease susceptibility by modulating macrophage interactions with mucosal organisms at the site of initial acquisition.

    참고자료
  • Jack DL, et al. (2005) Mannose-binding lectin enhances phagocytosis and killing of Neisseria meningitidis by human macrophages. J Leukoc Biol. 77(3): 328-36.
  • Lillie BN, et al. (2006) Single-nucleotide polymorphisms in porcine mannan-binding lectin A. Immunogenetics. 58(12): 983-93.
  • Nikolakopoulou K, et al. (2006) Molecular cloning and characterisation of two homologues of Mannose-Binding Lectin in rainbow trout. Fish Shellfish Immunol. 21(3): 305-14.
  • Phatsara C, et al. (2007) Molecular genetic analysis of porcine mannose-binding lectin genes, MBL1 and MBL2, and their association with complement activity. Int J Immunogenet. 34(1): 55-63.
  • Size / Price
    Cat No: RG80251-UT
    정가: 
    가격:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".