MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80716-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MGST1/Microsomal glutathione S-transferase 1 Reagents
CRO Services
Product recommended

All MGST1/Microsomal glutathione S-transferase 1 Reagents
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
468 bp
Description
Full length Clone DNA of Rat microsomal glutathione S-transferase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGST1/Microsomal glutathione S-transferase 1 Background Information
Full Name
microsomal glutathione S-transferase 1

MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone in Cloning Vector, Rat RG80716-G
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, untagged RG80716-UT
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80716-ACG
MGST1/Microsomal glutathione S-transferase 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80716-ACGLN
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80716-ACR
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80716-CF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80716-NF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-His tag RG80716-CH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, N-His tag RG80716-NH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-HA tag RG80716-CY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, N-HA tag RG80716-NY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Rat, C-Myc tag RG80716-CM
MGST1/Microsomal glutathione S-transferase 1 qPCR Primer Pairs, Rat RP300680

MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone in Cloning Vector, Mouse MG53247-U
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, untagged MG53247-UT
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53247-ACG
MGST1/Microsomal glutathione S-transferase 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53247-ACGLN
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53247-ACR
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53247-CF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53247-NF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-His tag MG53247-CH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, N-His tag MG53247-NH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-HA tag MG53247-CY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, N-HA tag MG53247-NY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, C-Myc tag MG53247-CM
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Mouse, N-Myc tag MG53247-NM

MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone in Cloning Vector, Human HG16248-G
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, untagged HG16248-UT
MGST1/Microsomal glutathione S-transferase 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16248-ACGLN
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16248-ACG
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16248-ANG
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16248-ACR
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16248-ANR
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16248-CF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16248-NF
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-His tag HG16248-CH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-His tag HG16248-NH
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-HA tag HG16248-CY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-HA tag HG16248-NY
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, C-Myc tag HG16248-CM
MGST1/Microsomal glutathione S-transferase 1 cDNA ORF Clone, Human, N-Myc tag HG16248-NM
MGST1/Microsomal glutathione S-transferase 1 qPCR Primer Pairs, Human HP105012
info info
添加购物车成功! 添加购物车失败!