After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 MSR1/CD204 Gene ORF cDNA clone expression plasmid, C-HA 태그

데이터시트리뷰관련제품프로토콜
Rat MSR1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001191939.1
cDNA 크기:1365bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus macrophage scavenger receptor 1 with C terminal HA tag.
유전자 동의어:RGD1564316, Msr1
:Rat
벡터:pCMV3-C-HA
Plasmid:
제한 사이트:
태그 씨퀀스:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
연구배경

Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger receptor class A member 1, CD204, MSR1 and SCARA1, is a single-pass type I I membrane protein which contains one collagen-like domain and one SRCR domain. Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). MSR1 / SCARA1 is one of the membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL). MSR1 / SCARA1 is also involved in chronic inflammation which is a risk factor for prostate cancer. MSR1 1 gene was identified as a candidate susceptibility gene for hereditary prostate cancer and as a risk factor for sporadic prostate cancer.

참고자료
  • Wang L. et al., 2003, Nat Genet. 35 (2): 128-9.
  • Chen Y.C. et al., 2008, Cancer Epidemiol Biomarkers Prev. 17 (4): 1001-3.
  • Shirato K. et al., 2009, Pflugers Arch. 459 (1): 93-103.
  • Sun J. et al., 2006, Prostate. 66 (7): 728-37.
  • Size / Price
    Cat No: RG80363-CY
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".