NDRG2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81132-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All NDRG2 Reagents
CRO Services
Product recommended

All NDRG2 Reagents
NDRG2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1074 bp
Description
Full length Clone DNA of Rat NDRG family member 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NDRG2 Background Information
Full Name
NDRG family member 2

NDRG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Rat RG81132-U
NDRG2 cDNA ORF Clone, Rat, untagged RG81132-UT
NDRG2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81132-ACG
NDRG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81132-ACGLN
NDRG2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81132-ANG
NDRG2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81132-ACR
NDRG2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81132-ANR
NDRG2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81132-CF
NDRG2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81132-NF
NDRG2 cDNA ORF Clone, Rat, C-His tag RG81132-CH
NDRG2 cDNA ORF Clone, Rat, N-His tag RG81132-NH
NDRG2 cDNA ORF Clone, Rat, C-HA tag RG81132-CY
NDRG2 cDNA ORF Clone, Rat, N-HA tag RG81132-NY
NDRG2 cDNA ORF Clone, Rat, N-Myc tag RG81132-NM
NDRG2 qPCR Primer Pairs, Rat RP301089

NDRG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Mouse MG51971-U
NDRG2 cDNA ORF Clone, Mouse, untagged MG51971-UT
NDRG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51971-ACGLN
NDRG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51971-ACG
NDRG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51971-ANG
NDRG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51971-ACR
NDRG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51971-ANR
NDRG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51971-CF
NDRG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51971-NF
NDRG2 cDNA ORF Clone, Mouse, C-His tag MG51971-CH
NDRG2 cDNA ORF Clone, Mouse, N-His tag MG51971-NH
NDRG2 cDNA ORF Clone, Mouse, C-HA tag MG51971-CY
NDRG2 cDNA ORF Clone, Mouse, N-HA tag MG51971-NY
NDRG2 cDNA ORF Clone, Mouse, C-Myc tag MG51971-CM
NDRG2 cDNA ORF Clone, Mouse, N-Myc tag MG51971-NM
NDRG2 qPCR Primer Pairs, Mouse MP201844

NDRG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NDRG2 cDNA ORF Clone in Cloning Vector, Human HG14184-G
NDRG2 cDNA ORF Clone, Human, untagged HG14184-UT
NDRG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14184-ACGLN
NDRG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14184-ACG
NDRG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14184-ANG
NDRG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14184-ACR
NDRG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14184-ANR
NDRG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14184-CF
NDRG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14184-NF
NDRG2 cDNA ORF Clone, Human, C-His tag HG14184-CH
NDRG2 cDNA ORF Clone, Human, N-His tag HG14184-NH
NDRG2 cDNA ORF Clone, Human, C-HA tag HG14184-CY
NDRG2 cDNA ORF Clone, Human, C-HA tag HG14184-G-Y
NDRG2 cDNA ORF Clone, Human, N-HA tag HG14184-NY
NDRG2 cDNA ORF Clone, Human, C-Myc tag HG14184-CM
NDRG2 cDNA ORF Clone, Human, N-Myc tag HG14184-NM
NDRG2 qPCR Primer Pairs, Human HP102835
info info
添加购物车成功! 添加购物车失败!