NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80705-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NGP/neutrophilic granule protein Reagents

CRO Services

Product recommended


All NGP/neutrophilic granule protein Reagents

NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
507 bp
Description
Full length Clone DNA of Rat neutrophilic granule protein with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NGP/neutrophilic granule protein Background Information

Full Name
neutrophilic granule protein

NGP/neutrophilic granule protein cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NGP/neutrophilic granule protein cDNA ORF Clone in Cloning Vector, Rat RG80705-U
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, untagged RG80705-UT
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-GFPSpark® tag RG80705-ACG
NGP/neutrophilic granule protein Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80705-ACGLN
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-GFPSpark® tag RG80705-ANG
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-OFPSpark® tag RG80705-ACR
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-OFPSpark® tag RG80705-ANR
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80705-CF
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80705-NF
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-His tag RG80705-CH
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-His tag RG80705-NH
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-HA tag RG80705-CY
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, N-HA tag RG80705-NY
NGP/neutrophilic granule protein cDNA ORF Clone, Rat, C-Myc tag RG80705-CM
NGP/neutrophilic granule protein qPCR Primer Pairs, Rat RP300669

NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NGP/neutrophilic granule protein cDNA ORF Clone in Cloning Vector, Mouse MG53053-G
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, untagged MG53053-UT
NGP/neutrophilic granule protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53053-ACGLN
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53053-ACG
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53053-ACR
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53053-CF
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53053-NF
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-His tag MG53053-CH
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, N-His tag MG53053-NH
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-HA tag MG53053-CY
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, N-HA tag MG53053-NY
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, C-Myc tag MG53053-CM
NGP/neutrophilic granule protein cDNA ORF Clone, Mouse, N-Myc tag MG53053-NM
info info
添加购物车成功! 添加购物车失败!