NONO/p54nrb cDNA ORF Clone, Rat, C-His tag

Cat: RG81632-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All NONO/p54nrb Reagents
CRO Services
Product recommended

All NONO/p54nrb Reagents
NONO/p54nrb cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1431 bp
Description
Full length Clone DNA of Rat non-POU domain containing, octamer-binding with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NONO/p54nrb Background Information
Full Name
non-POU domain containing, octamer-binding

NONO/p54nrb cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NONO/p54nrb cDNA ORF Clone in Cloning Vector, Rat RG81632-G
NONO/p54nrb cDNA ORF Clone, Rat, untagged RG81632-UT
NONO/p54nrb cDNA ORF Clone, Rat, C-GFPSpark® tag RG81632-ACG
NONO/p54nrb Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81632-ACGLN
NONO/p54nrb cDNA ORF Clone, Rat, N-GFPSpark® tag RG81632-ANG
NONO/p54nrb cDNA ORF Clone, Rat, C-OFPSpark® tag RG81632-ACR
NONO/p54nrb cDNA ORF Clone, Rat, N-OFPSpark® tag RG81632-ANR
NONO/p54nrb cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81632-CF
NONO/p54nrb cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81632-NF
NONO/p54nrb cDNA ORF Clone, Rat, N-His tag RG81632-NH
NONO/p54nrb cDNA ORF Clone, Rat, C-HA tag RG81632-CY
NONO/p54nrb cDNA ORF Clone, Rat, N-HA tag RG81632-NY
NONO/p54nrb cDNA ORF Clone, Rat, C-Myc tag RG81632-CM
NONO/p54nrb cDNA ORF Clone, Rat, N-Myc tag RG81632-NM

NONO/p54nrb cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NONO/p54nrb cDNA ORF Clone in Cloning Vector, Human HG14826-G
NONO/p54nrb cDNA ORF Clone, Human, untagged HG14826-UT
NONO/p54nrb Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14826-ACGLN
NONO/p54nrb cDNA ORF Clone, Human, C-GFPSpark® tag HG14826-ACG
NONO/p54nrb cDNA ORF Clone, Human, N-GFPSpark® tag HG14826-ANG
NONO/p54nrb cDNA ORF Clone, Human, C-OFPSpark® tag HG14826-ACR
NONO/p54nrb cDNA ORF Clone, Human, N-OFPSpark® tag HG14826-ANR
NONO/p54nrb cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14826-CF
NONO/p54nrb cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14826-NF
NONO/p54nrb cDNA ORF Clone, Human, C-His tag HG14826-CH
NONO/p54nrb cDNA ORF Clone, Human, N-His tag HG14826-NH
NONO/p54nrb cDNA ORF Clone, Human, C-HA tag HG14826-CY
NONO/p54nrb cDNA ORF Clone, Human, N-HA tag HG14826-NY
NONO/p54nrb cDNA ORF Clone, Human, C-Myc tag HG14826-CM
NONO/p54nrb cDNA ORF Clone, Human, N-Myc tag HG14826-NM
NONO/p54nrb qPCR Primer Pairs, Human HP100008
info info
添加购物车成功! 添加购物车失败!