NPC2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80706-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NPC2 Reagents

CRO Services

Product recommended


All NPC2 Reagents

NPC2 cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
459 bp
Description
Full length Clone DNA of Rat Niemann-Pick disease, type C2 with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NPC2 Background Information

Full Name
Niemann-Pick disease, type C2

NPC2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
NPC2 cDNA ORF Clone in Cloning Vector, Rat RG80706-U
NPC2 cDNA ORF Clone, Rat, untagged RG80706-UT
NPC2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80706-ACG
NPC2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80706-ACGLN
NPC2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80706-ACR
NPC2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80706-CF
NPC2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80706-NF
NPC2 cDNA ORF Clone, Rat, C-His tag RG80706-CH
NPC2 cDNA ORF Clone, Rat, N-His tag RG80706-NH
NPC2 cDNA ORF Clone, Rat, C-HA tag RG80706-CY
NPC2 cDNA ORF Clone, Rat, N-HA tag RG80706-NY
NPC2 cDNA ORF Clone, Rat, C-Myc tag RG80706-CM
NPC2 qPCR Primer Pairs, Rat RP300670

NPC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NPC2 cDNA ORF Clone in Cloning Vector, Mouse MG52313-U
NPC2 cDNA ORF Clone, Mouse, untagged MG52313-UT
NPC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52313-ACG
NPC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52313-ACGLN
NPC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52313-ACR
NPC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52313-CF
NPC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52313-NF
NPC2 cDNA ORF Clone, Mouse, C-His tag MG52313-CH
NPC2 cDNA ORF Clone, Mouse, N-His tag MG52313-NH
NPC2 cDNA ORF Clone, Mouse, C-HA tag MG52313-CY
NPC2 cDNA ORF Clone, Mouse, N-HA tag MG52313-NY
NPC2 cDNA ORF Clone, Mouse, C-Myc tag MG52313-CM
NPC2 cDNA ORF Clone, Mouse, N-Myc tag MG52313-NM
NPC2 qPCR Primer Pairs, Mouse MP202186

NPC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NPC2 cDNA ORF Clone in Cloning Vector, Human HG13341-G
NPC2 cDNA ORF Clone, Human, untagged HG13341-UT
NPC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13341-ACGLN
NPC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13341-ACG
NPC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13341-ACR
NPC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13341-CF
NPC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13341-NF
NPC2 cDNA ORF Clone, Human, C-His tag HG13341-CH
NPC2 cDNA ORF Clone, Human, N-His tag HG13341-NH
NPC2 cDNA ORF Clone, Human, C-HA tag HG13341-CY
NPC2 cDNA ORF Clone, Human, N-HA tag HG13341-NY
NPC2 cDNA ORF Clone, Human, C-Myc tag HG13341-CM
NPC2 cDNA ORF Clone, Human, N-Myc tag HG13341-NM
NPC2 qPCR Primer Pairs, Human HP102046
info info
添加购物车成功! 添加购物车失败!