After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat NUDT5 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001007733.1
cDNA 크기:660bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.
유전자 동의어:Nudt5
:Rat
벡터:pCMV3-C-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Flag 태그 on other vectors
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그RG81109-ACG265260
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그RG81109-ACR265260
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그RG81109-ANG265260
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그RG81109-ANR265260
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Flag 태그RG81109-CF229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-His 태그RG81109-CH229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-Myc 태그RG81109-CM229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, C-HA 태그RG81109-CY229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-Flag 태그RG81109-NF229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-His 태그RG81109-NH229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-Myc 태그RG81109-NM229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmid, N-HA 태그RG81109-NY229890
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone in cloning vectorRG81109-U88420
쥐 ADP-sugar Pyrophosphatase/NUDT5 Gene ORF cDNA clone expression plasmidRG81109-UT229890
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

참고자료
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Cat No: RG81109-CF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".