NUDT5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81109-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NUDT5 Reagents

CRO Services

Product recommended


All NUDT5 Reagents

NUDT5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Rat nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NUDT5 Background Information

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

Full Name
nudix (nucleoside diphosphate linked moiety X)-type motif 5
References
  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • NUDT5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    NUDT5 cDNA ORF Clone in Cloning Vector, Rat RG81109-U
    NUDT5 cDNA ORF Clone, Rat, untagged RG81109-UT
    NUDT5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81109-ACG
    NUDT5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81109-ACGLN
    NUDT5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81109-ANG
    NUDT5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81109-ACR
    NUDT5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81109-ANR
    NUDT5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81109-NF
    NUDT5 cDNA ORF Clone, Rat, C-His tag RG81109-CH
    NUDT5 cDNA ORF Clone, Rat, N-His tag RG81109-NH
    NUDT5 cDNA ORF Clone, Rat, C-HA tag RG81109-CY
    NUDT5 cDNA ORF Clone, Rat, N-HA tag RG81109-NY
    NUDT5 cDNA ORF Clone, Rat, C-Myc tag RG81109-CM
    NUDT5 cDNA ORF Clone, Rat, N-Myc tag RG81109-NM
    NUDT5 qPCR Primer Pairs, Rat RP301066

    NUDT5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    NUDT5 cDNA ORF Clone in Cloning Vector, Mouse MG5A3862-U
    NUDT5 cDNA ORF Clone, Mouse, untagged MG5A3862-UT
    NUDT5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3862-ACGLN
    NUDT5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3862-ACG
    NUDT5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3862-ANG
    NUDT5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3862-ACR
    NUDT5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3862-ANR
    NUDT5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3862-CF
    NUDT5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3862-NF
    NUDT5 cDNA ORF Clone, Mouse, C-His tag MG5A3862-CH
    NUDT5 cDNA ORF Clone, Mouse, N-His tag MG5A3862-NH
    NUDT5 cDNA ORF Clone, Mouse, C-HA tag MG5A3862-CY
    NUDT5 cDNA ORF Clone, Mouse, N-HA tag MG5A3862-NY
    NUDT5 cDNA ORF Clone, Mouse, C-Myc tag MG5A3862-CM
    NUDT5 cDNA ORF Clone, Mouse, N-Myc tag MG5A3862-NM

    NUDT5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    NUDT5 cDNA ORF Clone in Cloning Vector, Human HG13068-G
    NUDT5 cDNA ORF Clone, Human, untagged HG13068-UT
    NUDT5 cDNA ORF Clone, Human, C-GFPSpark® tag HG13068-ACG
    NUDT5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13068-ACGLN
    NUDT5 cDNA ORF Clone, Human, N-GFPSpark® tag HG13068-ANG
    NUDT5 cDNA ORF Clone, Human, C-OFPSpark® tag HG13068-ACR
    NUDT5 cDNA ORF Clone, Human, N-OFPSpark® tag HG13068-ANR
    NUDT5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13068-CF
    NUDT5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13068-NF
    NUDT5 cDNA ORF Clone, Human, C-His tag HG13068-CH
    NUDT5 cDNA ORF Clone, Human, N-His tag HG13068-NH
    NUDT5 cDNA ORF Clone, Human, C-HA tag HG13068-CY
    NUDT5 cDNA ORF Clone, Human, N-HA tag HG13068-NY
    NUDT5 cDNA ORF Clone, Human, C-Myc tag HG13068-CM
    NUDT5 cDNA ORF Clone, Human, N-Myc tag HG13068-NM
    NUDT5 qPCR Primer Pairs, Human HP101688
    info info
    添加购物车成功! 添加购物车失败!