OIF cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81140-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OIF Reagents
CRO Services
Product recommended

All OIF Reagents
OIF cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
897 bp
Description
Full length Clone DNA of Rat osteoglycin with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OIF Background Information
Full Name
osteoglycin

OIF cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OIF cDNA ORF Clone in Cloning Vector, Rat RG81140-U
OIF cDNA ORF Clone, Rat, untagged RG81140-UT
OIF cDNA ORF Clone, Rat, C-GFPSpark® tag RG81140-ACG
OIF Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81140-ACGLN
OIF cDNA ORF Clone, Rat, C-OFPSpark® tag RG81140-ACR
OIF cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81140-CF
OIF cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81140-NF
OIF cDNA ORF Clone, Rat, C-His tag RG81140-CH
OIF cDNA ORF Clone, Rat, N-His tag RG81140-NH
OIF cDNA ORF Clone, Rat, C-HA tag RG81140-CY
OIF cDNA ORF Clone, Rat, N-HA tag RG81140-NY
OIF cDNA ORF Clone, Rat, N-Myc tag RG81140-NM
OIF qPCR Primer Pairs, Rat RP301097

OIF cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OIF cDNA ORF Clone in Cloning Vector, Mouse MG50064-M
OIF cDNA ORF Clone, Mouse, untagged MG50064-UT
OIF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50064-ACGLN
OIF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50064-ACG
OIF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50064-ACR
OIF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50064-CF
OIF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50064-NF
OIF cDNA ORF Clone, Mouse, C-His tag MG50064-CH
OIF cDNA ORF Clone, Mouse, N-His tag MG50064-NH
OIF cDNA ORF Clone, Mouse, C-HA tag MG50064-CY
OIF cDNA ORF Clone, Mouse, N-HA tag MG50064-NY
OIF cDNA ORF Clone, Mouse, C-Myc tag MG50064-CM
OIF cDNA ORF Clone, Mouse, N-Myc tag MG50064-NM
OIF qPCR Primer Pairs, Mouse MP200064

OIF cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OIF cDNA ORF Clone in Cloning Vector, Human HG13478-G
OIF cDNA ORF Clone, Human, untagged HG13478-UT
OIF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13478-ACGLN
OIF cDNA ORF Clone, Human, C-GFPSpark® tag HG13478-ACG
OIF cDNA ORF Clone, Human, C-OFPSpark® tag HG13478-ACR
OIF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13478-CF
OIF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13478-NF
OIF cDNA ORF Clone, Human, C-His tag HG13478-CH
OIF cDNA ORF Clone, Human, N-His tag HG13478-NH
OIF cDNA ORF Clone, Human, C-HA tag HG13478-CY
OIF cDNA ORF Clone, Human, N-HA tag HG13478-NY
OIF cDNA ORF Clone, Human, C-Myc tag HG13478-CM
OIF cDNA ORF Clone, Human, N-Myc tag HG13478-NM
OIF qPCR Primer Pairs, Human HP102178
info info
添加购物车成功! 添加购物车失败!