OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80717-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All OSTC/oligosaccharyltransferase complex subunit Reagents
CRO Services
Product recommended

All OSTC/oligosaccharyltransferase complex subunit Reagents
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Rat oligosaccharyltransferase complex subunit (non-catalytic) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-Myc tag Alternative Names
Dc2 cDNA ORF Clone, Rat;RGD1560708 cDNA ORF Clone, Rat
OSTC/oligosaccharyltransferase complex subunit Background Information
Full Name
oligosaccharyltransferase complex subunit (non-catalytic)

OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone in Cloning Vector, Rat RG80717-U
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, untagged RG80717-UT
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-GFPSpark® tag RG80717-ACG
OSTC/oligosaccharyltransferase complex subunit Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80717-ACGLN
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-OFPSpark® tag RG80717-ACR
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80717-CF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80717-NF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-His tag RG80717-CH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-His tag RG80717-NH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-HA tag RG80717-CY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, N-HA tag RG80717-NY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Rat, C-Myc tag RG80717-CM
OSTC/oligosaccharyltransferase complex subunit qPCR Primer Pairs, Rat RP300681

OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone in Cloning Vector, Mouse MG53358-U
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, untagged MG53358-UT
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53358-ACG
OSTC/oligosaccharyltransferase complex subunit Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53358-ACGLN
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53358-ACR
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53358-CF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53358-NF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-His tag MG53358-CH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, N-His tag MG53358-NH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-HA tag MG53358-CY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, N-HA tag MG53358-NY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, C-Myc tag MG53358-CM
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Mouse, N-Myc tag MG53358-NM

OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone in Cloning Vector, Human HG16683-U
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, untagged HG16683-UT
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-GFPSpark® tag HG16683-ACG
OSTC/oligosaccharyltransferase complex subunit Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16683-ACGLN
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-OFPSpark® tag HG16683-ACR
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16683-CF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16683-NF
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-His tag HG16683-CH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, N-His tag HG16683-NH
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-HA tag HG16683-CY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, N-HA tag HG16683-NY
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, C-Myc tag HG16683-CM
OSTC/oligosaccharyltransferase complex subunit cDNA ORF Clone, Human, N-Myc tag HG16683-NM
info info
添加购物车成功! 添加购物车失败!