PD-1 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80448-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PD-1 Reagents

CRO Services

Product recommended


All PD-1 Reagents

PD-1 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
854 bp
Description
Full length Clone DNA of Rat programmedcelldeath1 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PD-1 Background Information

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

Immune Checkpoint
Immune Checkpoint Blockade: Blocking Antibodies   Immune Checkpoint Blockade: PD1 / PDCD1 / CD279 Blocking Antibodies
Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: IHC Antibodies   Immune Checkpoint Detection: WB Antibodies
Immune Checkpoint Proteins   PD1 / PDCD1 / CD279 Immune Checkpoint Proteins
PD1 / PDCD1 / CD279 Immune Checkpoint   PD1 / PDCD1 / CD279 Immune Checkpoint Antibodies
Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
programmed cell death 1
References
  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • PD-1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    PD-1 cDNA ORF Clone in Cloning Vector, Rhesus KG90305-G
    PD-1 cDNA ORF Clone, Rhesus, untagged KG90305-UT
    PD-1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag KG90305-ACGLN
    PD-1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag KG90305-ACG
    PD-1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag KG90305-ACR
    PD-1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag KG90305-CF
    PD-1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag KG90305-NF
    PD-1 cDNA ORF Clone, Rhesus, C-His tag KG90305-CH
    PD-1 cDNA ORF Clone, Rhesus, N-His tag KG90305-NH
    PD-1 cDNA ORF Clone, Rhesus, C-HA tag KG90305-CY
    PD-1 cDNA ORF Clone, Rhesus, N-HA tag KG90305-NY
    PD-1 cDNA ORF Clone, Rhesus, C-Myc tag KG90305-CM
    PD-1 cDNA ORF Clone, Rhesus, N-Myc tag KG90305-NM

    PD-1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    PD-1 cDNA ORF Clone in Cloning Vector, Canine DG70109-G
    PD-1 cDNA ORF Clone, Canine, untagged DG70109-UT
    PD-1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70109-ACGLN
    PD-1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70109-ACG
    PD-1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70109-ACR
    PD-1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70109-CF
    PD-1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70109-NF
    PD-1 cDNA ORF Clone, Canine, C-His tag DG70109-CH
    PD-1 cDNA ORF Clone, Canine, N-His tag DG70109-NH
    PD-1 cDNA ORF Clone, Canine, C-HA tag DG70109-CY
    PD-1 cDNA ORF Clone, Canine, N-HA tag DG70109-NY
    PD-1 cDNA ORF Clone, Canine, C-Myc tag DG70109-CM
    PD-1 cDNA ORF Clone, Canine, N-Myc tag DG70109-NM

    PD-1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    PD-1 cDNA ORF Clone in Cloning Vector, Rat RG80448-G
    PD-1 cDNA ORF Clone, Rat, untagged RG80448-UT
    PD-1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80448-ACGLN
    PD-1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80448-ACG
    PD-1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80448-ACR
    PD-1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80448-CF
    PD-1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80448-NF
    PD-1 cDNA ORF Clone, Rat, C-His tag RG80448-CH
    PD-1 cDNA ORF Clone, Rat, N-His tag RG80448-NH
    PD-1 cDNA ORF Clone, Rat, C-HA tag RG80448-CY
    PD-1 cDNA ORF Clone, Rat, C-Myc tag RG80448-CM
    PD-1 cDNA ORF Clone, Rat, N-Myc tag RG80448-NM
    PD-1 qPCR Primer Pairs, Rat RP300415

    PD-1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    PD-1 cDNA ORF Clone in Cloning Vector, Mouse MG50124-M
    PD-1 cDNA ORF Clone, Mouse, untagged MG50124-UT
    PD-1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50124-ACG
    PD-1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50124-ACGLN
    PD-1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50124-ACR
    PD-1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50124-CF
    PD-1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50124-NF
    PD-1 cDNA ORF Clone, Mouse, C-His tag MG50124-CH
    PD-1 cDNA ORF Clone, Mouse, N-His tag MG50124-NH
    PD-1 cDNA ORF Clone, Mouse, C-HA tag MG50124-CY
    PD-1 cDNA ORF Clone, Mouse, N-HA tag MG50124-NY
    PD-1 cDNA ORF Clone, Mouse, C-Myc tag MG50124-CM
    PD-1 cDNA ORF Clone, Mouse, N-Myc tag MG50124-NM
    PD-1 qPCR Primer Pairs, Mouse MP200154

    PD-1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    PD-1 cDNA ORF Clone in Cloning Vector, Human HG10377-M
    PD-1 cDNA ORF Clone, Human, untagged HG10377-UT
    PD-1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10377-ACG
    PD-1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10377-ACGLN
    PD-1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10377-ACR
    PD-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10377-CF
    PD-1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10377-NF
    PD-1 cDNA ORF Clone, Human, C-His tag HG10377-CH
    PD-1 cDNA ORF Clone, Human, N-His tag HG10377-NH
    PD-1 cDNA ORF Clone, Human, C-HA tag HG10377-CY
    PD-1 cDNA ORF Clone, Human, N-HA tag HG10377-NY
    PD-1 cDNA ORF Clone, Human, C-Myc tag HG10377-CM
    PD-1 cDNA ORF Clone, Human, N-Myc tag HG10377-NM
    PD-1 qPCR Primer Pairs, Human HP100412
    info info
    添加购物车成功! 添加购物车失败!