PRDX3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81103-CF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All PRDX3 Reagents

CRO Services

Product recommended


All PRDX3 Reagents

PRDX3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
774 bp
Description
Full length Clone DNA of Rat peroxiredoxin 3 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

PRDX3 Background Information

Full Name
peroxiredoxin 3

PRDX3 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Canine DG70217-U
PRDX3 cDNA ORF Clone, Canine, untagged DG70217-UT
PRDX3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70217-ACGLN
PRDX3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70217-ACG
PRDX3 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70217-ANG
PRDX3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70217-ACR
PRDX3 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70217-ANR
PRDX3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70217-CF
PRDX3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70217-NF
PRDX3 cDNA ORF Clone, Canine, C-His tag DG70217-CH
PRDX3 cDNA ORF Clone, Canine, N-His tag DG70217-NH
PRDX3 cDNA ORF Clone, Canine, C-HA tag DG70217-CY
PRDX3 cDNA ORF Clone, Canine, N-HA tag DG70217-NY
PRDX3 cDNA ORF Clone, Canine, C-Myc tag DG70217-CM
PRDX3 cDNA ORF Clone, Canine, N-Myc tag DG70217-NM

PRDX3 cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Ferret FG60068-G
PRDX3 cDNA ORF Clone, Ferret, untagged FG60068-UT
PRDX3 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60068-ACG
PRDX3 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60068-ACGLN
PRDX3 cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60068-ANG
PRDX3 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60068-ACR
PRDX3 cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60068-ANR
PRDX3 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60068-CF
PRDX3 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60068-NF
PRDX3 cDNA ORF Clone, Ferret, C-His tag FG60068-CH
PRDX3 cDNA ORF Clone, Ferret, N-His tag FG60068-NH
PRDX3 cDNA ORF Clone, Ferret, C-HA tag FG60068-CY
PRDX3 cDNA ORF Clone, Ferret, N-HA tag FG60068-NY
PRDX3 cDNA ORF Clone, Ferret, C-Myc tag FG60068-CM
PRDX3 cDNA ORF Clone, Ferret, N-Myc tag FG60068-NM

PRDX3 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Rabbit TG65118-G
PRDX3 cDNA ORF Clone, Rabbit, untagged TG65118-UT
PRDX3 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65118-ACGLN
PRDX3 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65118-ACG
PRDX3 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65118-ANG
PRDX3 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65118-ACR
PRDX3 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65118-ANR
PRDX3 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65118-CF
PRDX3 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65118-NF
PRDX3 cDNA ORF Clone, Rabbit, C-His tag TG65118-CH
PRDX3 cDNA ORF Clone, Rabbit, N-His tag TG65118-NH
PRDX3 cDNA ORF Clone, Rabbit, C-HA tag TG65118-CY
PRDX3 cDNA ORF Clone, Rabbit, N-HA tag TG65118-NY
PRDX3 cDNA ORF Clone, Rabbit, C-Myc tag TG65118-CM
PRDX3 cDNA ORF Clone, Rabbit, N-Myc tag TG65118-NM

PRDX3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Rat RG81103-U
PRDX3 cDNA ORF Clone, Rat, untagged RG81103-UT
PRDX3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81103-ACG
PRDX3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81103-ACGLN
PRDX3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81103-ANG
PRDX3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81103-ACR
PRDX3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81103-ANR
PRDX3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81103-NF
PRDX3 cDNA ORF Clone, Rat, C-His tag RG81103-CH
PRDX3 cDNA ORF Clone, Rat, N-His tag RG81103-NH
PRDX3 cDNA ORF Clone, Rat, C-HA tag RG81103-CY
PRDX3 cDNA ORF Clone, Rat, N-HA tag RG81103-NY
PRDX3 cDNA ORF Clone, Rat, C-Myc tag RG81103-CM
PRDX3 cDNA ORF Clone, Rat, N-Myc tag RG81103-NM
PRDX3 qPCR Primer Pairs, Rat RP301060

PRDX3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Mouse MG52588-G
PRDX3 cDNA ORF Clone, Mouse, untagged MG52588-UT
PRDX3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52588-ACG
PRDX3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52588-ACGLN
PRDX3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52588-ANG
PRDX3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52588-ACR
PRDX3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52588-ANR
PRDX3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52588-CF
PRDX3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52588-NF
PRDX3 cDNA ORF Clone, Mouse, C-His tag MG52588-CH
PRDX3 cDNA ORF Clone, Mouse, N-His tag MG52588-NH
PRDX3 cDNA ORF Clone, Mouse, C-HA tag MG52588-CY
PRDX3 cDNA ORF Clone, Mouse, N-HA tag MG52588-NY
PRDX3 cDNA ORF Clone, Mouse, C-Myc tag MG52588-CM
PRDX3 cDNA ORF Clone, Mouse, N-Myc tag MG52588-NM
PRDX3 qPCR Primer Pairs, Mouse MP202459

PRDX3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
PRDX3 cDNA ORF Clone in Cloning Vector, Human HG11256-M
PRDX3 cDNA ORF Clone, Human, untagged HG11256-UT
PRDX3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11256-ACG
PRDX3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11256-ACGLN
PRDX3 cDNA ORF Clone, Human, N-GFPSpark® tag HG11256-ANG
PRDX3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11256-ACR
PRDX3 cDNA ORF Clone, Human, N-OFPSpark® tag HG11256-ANR
PRDX3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11256-CF
PRDX3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11256-NF
PRDX3 cDNA ORF Clone, Human, C-His tag HG11256-CH
PRDX3 cDNA ORF Clone, Human, N-His tag HG11256-NH
PRDX3 cDNA ORF Clone, Human, C-HA tag HG11256-CY
PRDX3 cDNA ORF Clone, Human, N-HA tag HG11256-NY
PRDX3 cDNA ORF Clone, Human, C-Myc tag HG11256-CM
PRDX3 cDNA ORF Clone, Human, N-Myc tag HG11256-NM
PRDX3 qPCR Primer Pairs, Human HP101140
info info
添加购物车成功! 添加购物车失败!