After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그

데이터시트리뷰관련제품프로토콜
Rat PTPRC cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001109890.1
cDNA 크기:3426bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus protein tyrosine phosphatase, receptor type, C, transcript variant 1 with C terminal His tag.
유전자 동의어:Lca, RT7, CD45, L-CA, T200, Ptprc
:Rat
벡터:pCMV3-C-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그 on other vectors
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark 태그RG80296-ACG383160
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark 태그RG80296-ACR383160
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark 태그RG80296-ANG383160
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark 태그RG80296-ANR383160
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag 태그RG80296-CF347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His 태그RG80296-CH347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc 태그RG80296-CM347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA 태그RG80296-CY347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone in cloning vectorRG80296-G88420
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag 태그RG80296-NF347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His 태그RG80296-NH347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc 태그RG80296-NM347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA 태그RG80296-NY347790
쥐 CD45/PTPRC transcript variant 1 Gene ORF cDNA clone expression plasmidRG80296-UT347790
 발현 벡터에 대해 자세히 알아보기
Product nameProduct name
연구배경

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

참고자료
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Cat No: RG80296-CH
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".