After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 CD111/Nectin-1/PVRL1 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Rat PVRL1 cDNA 클론 제품 정보
Gene_bank_ref_id:XM_236210.5
cDNA 크기:1548bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus poliovirus receptor-related 1.
유전자 동의어:HveC, nectin-1, Pvrl1
:Rat
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

Poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin-1; CD111), also known as PVRL1 is a cell adhesion molecule belonging to the immunoglobulin superfamily that can bind to virion glycoprotein D (gD) to mediate entry of herpes simplex viruses (HSV) and pseudorabies virus (PRV). CD111/Nectin-1/PVRL1 colocalizes with E-cadherin at adherens junctions in epithelial cells. The disruption of cell junctions can result in the redistribution of nectin-1. To determine whether disruption of junctions by calcium depletion influenced the susceptibility of epithelial cells to viral entry, Madin-Darby canine kidney cells expressing endogenous nectin-1 or transfected human nectin-1 were tested for the ability to bind soluble forms of viral gD and to be infected by HSV and PRV, before and after calcium depletion. It has been revealed that binding of HSV and PRV gD was localized to adherens junctions in cells maintained in normal medium but was distributed, along with nectin-1, over the entire cell surface after calcium depletion. Both the binding of gD and the fraction of cells that could be infected by HSV-1 and PRV were enhanced by calcium depletion. Taken together, CD111/Nectin-1/PVRL1 confined to adherens junctions in epithelial cells is not very accessible to virus, whereas dissociation of cell junctions releases nectin-1 to serve more efficiently as an entry recptor.

참고자료
  • Yoon M, et al. (2002) Disruption of adherens junctions liberates nectin-1 to serve as receptor for herpes simplex virus and pseudorabies virus entry. J Virol. 76(14): 7203-8.
  • Mata M, et al. (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7(5): 476-80.
  • Haarr L, et al. (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology. 287(2): 301-9.
  • Size / Price
    Cat No: RG80244-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".