RABGGTA cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Cat: RG81597-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RABGGTA Reagents

CRO Services

Product recommended


All RABGGTA Reagents

RABGGTA cDNA ORF Clone, Rat, N-DDK (Flag®) tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1704 bp
Description
Full length Clone DNA of Rat Rab geranylgeranyltransferase, alpha subunit with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RABGGTA Background Information

Full Name
Rab geranylgeranyl transferase, a subunit

RABGGTA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RABGGTA cDNA ORF Clone in Cloning Vector, Rat RG81597-G
RABGGTA cDNA ORF Clone, Rat, untagged RG81597-UT
RABGGTA cDNA ORF Clone, Rat, C-GFPSpark® tag RG81597-ACG
RABGGTA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81597-ACGLN
RABGGTA cDNA ORF Clone, Rat, N-GFPSpark® tag RG81597-ANG
RABGGTA cDNA ORF Clone, Rat, C-OFPSpark® tag RG81597-ACR
RABGGTA cDNA ORF Clone, Rat, N-OFPSpark® tag RG81597-ANR
RABGGTA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81597-CF
RABGGTA cDNA ORF Clone, Rat, C-His tag RG81597-CH
RABGGTA cDNA ORF Clone, Rat, N-His tag RG81597-NH
RABGGTA cDNA ORF Clone, Rat, C-HA tag RG81597-CY
RABGGTA cDNA ORF Clone, Rat, N-HA tag RG81597-NY
RABGGTA cDNA ORF Clone, Rat, C-Myc tag RG81597-CM
RABGGTA cDNA ORF Clone, Rat, N-Myc tag RG81597-NM

RABGGTA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RABGGTA cDNA ORF Clone in Cloning Vector, Human HG21637-U
RABGGTA cDNA ORF Clone, Human, untagged HG21637-UT
RABGGTA cDNA ORF Clone, Human, C-GFPSpark® tag HG21637-ACG
RABGGTA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG21637-ACGLN
RABGGTA cDNA ORF Clone, Human, N-GFPSpark® tag HG21637-ANG
RABGGTA cDNA ORF Clone, Human, C-OFPSpark® tag HG21637-ACR
RABGGTA cDNA ORF Clone, Human, N-OFPSpark® tag HG21637-ANR
RABGGTA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG21637-CF
RABGGTA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG21637-NF
RABGGTA cDNA ORF Clone, Human, C-His tag HG21637-CH
RABGGTA cDNA ORF Clone, Human, N-His tag HG21637-NH
RABGGTA cDNA ORF Clone, Human, C-HA tag HG21637-CY
RABGGTA cDNA ORF Clone, Human, N-HA tag HG21637-NY
RABGGTA cDNA ORF Clone, Human, C-Myc tag HG21637-CM
RABGGTA cDNA ORF Clone, Human, N-Myc tag HG21637-NM
info info
添加购物车成功! 添加购物车失败!