After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 RELT/TNFRSF19L Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat RELT cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001108495.1
cDNA 크기:1284bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus RELT tumor necrosis factor receptor with N terminal Flag tag.
유전자 동의어:Tnfrsf19l, Relt
:Rat
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Receptor expressed in lymphoid tissues (RELT), also known as tumor necrosis factor receptor superfamily, member 19-like (TNFRSF19L), is a member of the TNF-receptor superfamily. This receptor is especially abundant in hematologic tissues. It has been shown to activate the NF-kappaB pathway and selectively bind TNF receptor-associated factor 1. RELT/TNFRSF19L is capable of stimulating T-cell proliferation in the presence of CD3 signaling, which suggests its regulatory role in immune response. RELT/TNFRSF19L is a type I transmembrane glycoprotein with a cysteine-rich extracellular domain, possessing significant homology to other members of the TNFR superfamily, especially TNFRSF19, DR3, OX40, and LTbeta receptor. RELT/TNFRSF19L is able to activate the NF-kappaB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. RELT/TNFRSF19L is able to activate the NF-κB pathway and selectively binds tumor necrosis factor receptor-associated factor 1. Although the soluble form of RELT fusion protein does not inhibit the one-way mixed lymphocyte reaction, immobilized RELT/TNFRSF19L is capable of costimulating T-cell proliferation in the presence of CD3 signaling.

참고자료
  • Sica GL, et al. (2001) RELT, a new member of the tumor necrosis factor receptor superfamily, is selectively expressed in hematopoietic tissues and activates transcription factor NF-kappaB. Blood. 97(9): 2702-7.
  • Polek TC, et al. (2006) The TNF receptor, RELT, binds SPAK and uses it to mediate p38 and JNK activation. Biochem Biophys Res Commun. 343(1): 125-34.
  • Cusick JK, et al. (2006) Identification of RELT homologues that associate with RELT and are phosphorylated by OSR1. Biochem Biophys Res Commun. 340(2): 535-43.
  • Size / Price
    Cat No: RG80168-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".