RHOC cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81119-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All RHOC Reagents

CRO Services

Product recommended


All RHOC Reagents

RHOC cDNA ORF Clone, Rat, C-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
582 bp
Description
Full length Clone DNA of Rat ras homolog family member C with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RHOC Background Information

Full Name
ras homolog family member C

RHOC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
RHOC cDNA ORF Clone in Cloning Vector, Rat RG81119-U
RHOC cDNA ORF Clone, Rat, untagged RG81119-UT
RHOC cDNA ORF Clone, Rat, C-GFPSpark® tag RG81119-ACG
RHOC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81119-ACGLN
RHOC cDNA ORF Clone, Rat, C-OFPSpark® tag RG81119-ACR
RHOC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81119-CF
RHOC cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81119-NF
RHOC cDNA ORF Clone, Rat, C-His tag RG81119-CH
RHOC cDNA ORF Clone, Rat, N-His tag RG81119-NH
RHOC cDNA ORF Clone, Rat, C-HA tag RG81119-CY
RHOC cDNA ORF Clone, Rat, N-HA tag RG81119-NY
RHOC cDNA ORF Clone, Rat, N-Myc tag RG81119-NM
RHOC qPCR Primer Pairs, Rat RP301076

RHOC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RHOC cDNA ORF Clone in Cloning Vector, Mouse MG51423-G
RHOC cDNA ORF Clone, Mouse, untagged MG51423-UT
RHOC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51423-ACG
RHOC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51423-ACGLN
RHOC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51423-ACR
RHOC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51423-CF
RHOC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51423-NF
RHOC cDNA ORF Clone, Mouse, C-His tag MG51423-CH
RHOC cDNA ORF Clone, Mouse, N-His tag MG51423-NH
RHOC cDNA ORF Clone, Mouse, C-HA tag MG51423-CY
RHOC cDNA ORF Clone, Mouse, N-HA tag MG51423-NY
RHOC cDNA ORF Clone, Mouse, C-Myc tag MG51423-CM
RHOC cDNA ORF Clone, Mouse, N-Myc tag MG51423-NM
RHOC qPCR Primer Pairs, Mouse MP201307

RHOC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RHOC cDNA ORF Clone in Cloning Vector, Human HG13166-G
RHOC cDNA ORF Clone, Human, untagged HG13166-UT
RHOC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13166-ACGLN
RHOC cDNA ORF Clone, Human, C-GFPSpark® tag HG13166-ACG
RHOC cDNA ORF Clone, Human, C-OFPSpark® tag HG13166-ACR
RHOC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13166-CF
RHOC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13166-NF
RHOC cDNA ORF Clone, Human, C-His tag HG13166-CH
RHOC cDNA ORF Clone, Human, N-His tag HG13166-NH
RHOC cDNA ORF Clone, Human, C-HA tag HG13166-CY
RHOC cDNA ORF Clone, Human, N-HA tag HG13166-NY
RHOC cDNA ORF Clone, Human, C-Myc tag HG13166-CM
RHOC cDNA ORF Clone, Human, N-Myc tag HG13166-NM
RHOC qPCR Primer Pairs, Human HP101718
info info
添加购物车成功! 添加购物车失败!