Rat SDC1 ORF mammalian expression plasmid, N-His tag

데이터시트리뷰관련제품프로토콜
Rat SDC1 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_013026.2
cDNA 크기:942bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus syndecan 1 with N terminal His tag.
유전자 동의어:HSPG, Synd1, SYNDECA, Syndecan, Sdc1
:Rat
벡터:pCMV3-SP-N-His
Plasmid:
제한 사이트:
태그 씨퀀스:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
연구배경

Syndecan-1 also known as SDC1 and CD138, is the most extensively studied member of the syndecan family. It is found mainly in epithelial cells, but its expression is developmentally regulated during embryonic development. Syndecan-1/SDC1/CD138 has been shown to mediate cell adhesion to several ECM molecules, and to act as a coreceptor for fibroblast growth factors, potent angiogenic growth factors involved also in differentiation. Syndecan-1/SDC1/CD138 expression is reduced during malignant transformation of various epithelia, and this loss correlates with the histological differentiation grade of squamous cell carcinomas, lacking from poorly differentiated tumours. In squamous cell carcinomas of the head and neck, positive syndecan-1 expression correlates with a more favourable prognosis. Experimental studies on the role of Syndecan-1 in malignant transformation have shown that Syndecan-1/SDC1/CD138 expression is associated with the maintenance of epithelial morphology, anchorage-dependent growth and inhibition of invasiveness in vitro.

참고자료
  • Inki P, et al. (1996) The role of syndecan-1 in malignancies. Ann Med. 28(1): 63-7.
  • Subramanian SV, et al. (1997) Regulated shedding of syndecan-1 and -4 ectodomains by thrombin and growth factor receptor activation. J Biol Chem. 272(23): 14713-20.
  • Park PW, et al. (2001) Exploitation of syndecan-1 shedding by Pseudomonas aeruginosa enhances virulence. Nature. 411(6833): 98-102.
  • Size / Price
    Cat No: RG80344-NH
    정가:   (Save )
    가격:      [How to order]
    재고정보
     배송안내
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".