SDHC cDNA ORF Clone, Rat, C-His tag

Cat: RG81633-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All SDHC Reagents
CRO Services
Product recommended

All SDHC Reagents
SDHC cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Rat succinate dehydrogenase complex, subunit C, integral membrane protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

SDHC Background Information
Full Name
succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa

SDHC cDNA ORF Clone, Ferret, Related Products

Product Name Catalog#(PDF)
SDHC cDNA ORF Clone in Cloning Vector, Ferret FG60156-G
SDHC cDNA ORF Clone, Ferret, untagged FG60156-UT
SDHC cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60156-ACG
SDHC Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60156-ACGLN
SDHC cDNA ORF Clone, Ferret, N-GFPSpark® tag FG60156-ANG
SDHC cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60156-ACR
SDHC cDNA ORF Clone, Ferret, N-OFPSpark® tag FG60156-ANR
SDHC cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60156-CF
SDHC cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60156-NF
SDHC cDNA ORF Clone, Ferret, C-His tag FG60156-CH
SDHC cDNA ORF Clone, Ferret, N-His tag FG60156-NH
SDHC cDNA ORF Clone, Ferret, C-HA tag FG60156-CY
SDHC cDNA ORF Clone, Ferret, N-HA tag FG60156-NY
SDHC cDNA ORF Clone, Ferret, C-Myc tag FG60156-CM
SDHC cDNA ORF Clone, Ferret, N-Myc tag FG60156-NM

SDHC cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
SDHC cDNA ORF Clone in Cloning Vector, Canine DG70172-U
SDHC cDNA ORF Clone, Canine, untagged DG70172-UT
SDHC Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70172-ACGLN
SDHC cDNA ORF Clone, Canine, C-GFPSpark® tag DG70172-ACG
SDHC cDNA ORF Clone, Canine, N-GFPSpark® tag DG70172-ANG
SDHC cDNA ORF Clone, Canine, C-OFPSpark® tag DG70172-ACR
SDHC cDNA ORF Clone, Canine, N-OFPSpark® tag DG70172-ANR
SDHC cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70172-CF
SDHC cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70172-NF
SDHC cDNA ORF Clone, Canine, C-His tag DG70172-CH
SDHC cDNA ORF Clone, Canine, N-His tag DG70172-NH
SDHC cDNA ORF Clone, Canine, C-HA tag DG70172-CY
SDHC cDNA ORF Clone, Canine, N-HA tag DG70172-NY
SDHC cDNA ORF Clone, Canine, C-Myc tag DG70172-CM
SDHC cDNA ORF Clone, Canine, N-Myc tag DG70172-NM

SDHC cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
SDHC cDNA ORF Clone in Cloning Vector, Rat RG81633-G
SDHC cDNA ORF Clone, Rat, untagged RG81633-UT
SDHC Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81633-ACGLN
SDHC cDNA ORF Clone, Rat, C-GFPSpark® tag RG81633-ACG
SDHC cDNA ORF Clone, Rat, N-GFPSpark® tag RG81633-ANG
SDHC cDNA ORF Clone, Rat, C-OFPSpark® tag RG81633-ACR
SDHC cDNA ORF Clone, Rat, N-OFPSpark® tag RG81633-ANR
SDHC cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81633-CF
SDHC cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81633-NF
SDHC cDNA ORF Clone, Rat, N-His tag RG81633-NH
SDHC cDNA ORF Clone, Rat, C-HA tag RG81633-CY
SDHC cDNA ORF Clone, Rat, N-HA tag RG81633-NY
SDHC cDNA ORF Clone, Rat, C-Myc tag RG81633-CM
SDHC cDNA ORF Clone, Rat, N-Myc tag RG81633-NM

SDHC cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
SDHC cDNA ORF Clone in Cloning Vector, Mouse MG52847-G
SDHC cDNA ORF Clone, Mouse, untagged MG52847-UT
SDHC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52847-ACGLN
SDHC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52847-ACG
SDHC cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52847-ANG
SDHC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52847-ACR
SDHC cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52847-ANR
SDHC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52847-CF
SDHC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52847-NF
SDHC cDNA ORF Clone, Mouse, C-His tag MG52847-CH
SDHC cDNA ORF Clone, Mouse, N-His tag MG52847-NH
SDHC cDNA ORF Clone, Mouse, C-HA tag MG52847-CY
SDHC cDNA ORF Clone, Mouse, N-HA tag MG52847-NY
SDHC cDNA ORF Clone, Mouse, C-Myc tag MG52847-CM
SDHC cDNA ORF Clone, Mouse, N-Myc tag MG52847-NM

SDHC cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
SDHC cDNA ORF Clone in Cloning Vector, Human HG14002-G
SDHC cDNA ORF Clone, Human, untagged HG14002-UT
SDHC cDNA ORF Clone, Human, C-GFPSpark® tag HG14002-ACG
SDHC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14002-ACGLN
SDHC cDNA ORF Clone, Human, N-GFPSpark® tag HG14002-ANG
SDHC cDNA ORF Clone, Human, C-OFPSpark® tag HG14002-ACR
SDHC cDNA ORF Clone, Human, N-OFPSpark® tag HG14002-ANR
SDHC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14002-CF
SDHC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14002-NF
SDHC cDNA ORF Clone, Human, C-His tag HG14002-CH
SDHC cDNA ORF Clone, Human, N-His tag HG14002-NH
SDHC cDNA ORF Clone, Human, C-HA tag HG14002-CY
SDHC cDNA ORF Clone, Human, N-HA tag HG14002-NY
SDHC cDNA ORF Clone, Human, C-Myc tag HG14002-CM
SDHC cDNA ORF Clone, Human, N-Myc tag HG14002-NM
SDHC qPCR Primer Pairs, Human HP102658
info info
添加购物车成功! 添加购物车失败!