After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 SerpinA11 Gene ORF cDNA clone expression plasmid

데이터시트리뷰관련제품프로토콜
Rat SERPINA11 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001166352.1
cDNA 크기:1269bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11.
유전자 동의어:Serpina11
:Rat
벡터:pCMV3-untagged
Plasmid:
제한 사이트:
태그 씨퀀스:
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
연구배경

Serpins are the largest and most diverse family of serine protease inhibitors which are involved in a number of fundamental biological processes such as blood coagulation, complement activation, fibrinolysis, angiogenesis, inflammation and tumor suppression and are expressed in a cell-specific manner. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors). Over 1000 serpins have been identified. Mouse Serpin A11, also known as SERPINA11, is a member of the serpin family.

참고자료
  • Irving JA. et al., 2000, Genome Res. 10: 1845-64. 
  • Irving J. et al., 2002, Mol Biol Evol 19 (11): 1881-90.
  • Forsyth, S. et al., 2003, Genomics 81: 336-345. 
  • Horvath, AJ. et al., 2004, J. Mol. Evol. 59: 488-497.
  • Steenbakkers PJ. et al., 2008, Mycol. Res. 112 (Pt 8): 999-1006.
  • Size / Price
    Cat No: RG81027-UT
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        최근에 조회한 품목
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".