Thy1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80337-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All Thy1 Reagents

CRO Services

Product recommended


All Thy1 Reagents

Thy1 cDNA ORF Clone, Rat, C-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
486 bp
Description
Full length Clone DNA of Rat Thy-1 cell surface antigen with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Thy1 Background Information

Thy-1 membrane glycoprotein, also known as Thy-1 antigen, CD90 and THY1, is a cell membrane protein which contains 1 Ig-like V-type (immunoglobulin-like) domain. It is a glycophosphatidylinositol-linked glycoprotein expressed on the surface of neurons, thymocytes, subsets of fibroblasts, endothelial cells, mesangial cells and some hematopoietic cells. It has been identified on a variety of stem cells and at varying levels in non-lymphoid tissues such as on fibroblasts, brain cells, and activated endothelial cells. Thy-1 is evolutionarily conserved, developmentally regulated, and often has dramatic effects on cell phenotype. Thy-1 is a 25-37 kDa glycosylphosphatidylinositol (GPI)-anchored protein involved in T cell activation, neurite outgrowth, apoptosis, tumor suppression, wound healing, and fibrosis. To mediate these diverse effects, Thy-1 participates in multiple signaling cascades. Thy-1 is an important regulator of cell-cell and cell-matrix interactions, with important roles in nerve regeneration, metastasis, inflammation, and fibrosis.

Full Name
Thy-1 cell surface antigen
References
  • Rege TA, et al. (2006) Thy-1 as a regulator of cell-cell and cell-matrix interactions in axon regeneration, apoptosis, adhesion, migration, cancer, and fibrosis. FASEB J. 20(8): 1045-54.
  • Fiegel HC, et al. (2008) Lack of Thy1 (CD90) expression in neuroblastomas is correlated with impaired survival. Pediatr Surg Int. 24(1): 101-5.
  • Bradley JE, et al. (2009) Roles and regulation of Thy-1, a context-dependent modulator of cell phenotype. Biofactors. 35(3): 258-65.
  • Kisselbach L, et al. (2009) CD90 Expression on human primary cells and elimination of contaminating fibroblasts from cell cultures. Cytotechnology. 59(1): 31-44.
  • Thy1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Rhesus CG90205-G
    Thy1 cDNA ORF Clone, Rhesus, untagged CG90205-UT
    Thy1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90205-ACGLN
    Thy1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90205-ACG
    Thy1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90205-ACR
    Thy1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90205-CF
    Thy1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90205-NF
    Thy1 cDNA ORF Clone, Rhesus, C-His tag CG90205-CH
    Thy1 cDNA ORF Clone, Rhesus, N-His tag CG90205-NH
    Thy1 cDNA ORF Clone, Rhesus, C-HA tag CG90205-CY
    Thy1 cDNA ORF Clone, Rhesus, N-HA tag CG90205-NY
    Thy1 cDNA ORF Clone, Rhesus, C-Myc tag CG90205-CM
    Thy1 cDNA ORF Clone, Rhesus, N-Myc tag CG90205-NM

    Thy1 cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Ferret FG60039-G
    Thy1 cDNA ORF Clone, Ferret, untagged FG60039-UT
    Thy1 Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60039-ACGLN
    Thy1 cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60039-ACG
    Thy1 cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60039-ACR
    Thy1 cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60039-CF
    Thy1 cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60039-NF
    Thy1 cDNA ORF Clone, Ferret, C-His tag FG60039-CH
    Thy1 cDNA ORF Clone, Ferret, N-His tag FG60039-NH
    Thy1 cDNA ORF Clone, Ferret, C-HA tag FG60039-CY
    Thy1 cDNA ORF Clone, Ferret, N-HA tag FG60039-NY
    Thy1 cDNA ORF Clone, Ferret, C-Myc tag FG60039-CM
    Thy1 cDNA ORF Clone, Ferret, N-Myc tag FG60039-NM

    Thy1 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Rabbit TG65053-G
    Thy1 cDNA ORF Clone, Rabbit, untagged TG65053-UT
    Thy1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65053-ACG
    Thy1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65053-ACR
    Thy1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65053-CF
    Thy1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65053-NF
    Thy1 cDNA ORF Clone, Rabbit, C-His tag TG65053-CH
    Thy1 cDNA ORF Clone, Rabbit, N-His tag TG65053-NH
    Thy1 cDNA ORF Clone, Rabbit, C-HA tag TG65053-CY
    Thy1 cDNA ORF Clone, Rabbit, N-HA tag TG65053-NY
    Thy1 cDNA ORF Clone, Rabbit, C-Myc tag TG65053-CM
    Thy1 cDNA ORF Clone, Rabbit, N-Myc tag TG65053-NM

    Thy1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Rat RG80337-G
    Thy1 cDNA ORF Clone, Rat, untagged RG80337-UT
    Thy1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80337-ACGLN
    Thy1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80337-ACG
    Thy1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80337-ACR
    Thy1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80337-CF
    Thy1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80337-NF
    Thy1 cDNA ORF Clone, Rat, C-His tag RG80337-CH
    Thy1 cDNA ORF Clone, Rat, N-His tag RG80337-NH
    Thy1 cDNA ORF Clone, Rat, N-HA tag RG80337-NY
    Thy1 cDNA ORF Clone, Rat, C-Myc tag RG80337-CM
    Thy1 cDNA ORF Clone, Rat, N-Myc tag RG80337-NM
    Thy1 qPCR Primer Pairs, Rat RP300307

    Thy1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Mouse MG50461-M
    Thy1 cDNA ORF Clone, Mouse, untagged MG50461-UT
    Thy1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50461-ACGLN
    Thy1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50461-ACG
    Thy1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50461-ACR
    Thy1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50461-CF
    Thy1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50461-NF
    Thy1 cDNA ORF Clone, Mouse, C-His tag MG50461-CH
    Thy1 cDNA ORF Clone, Mouse, N-His tag MG50461-NH
    Thy1 cDNA ORF Clone, Mouse, C-HA tag MG50461-CY
    Thy1 cDNA ORF Clone, Mouse, N-HA tag MG50461-NY
    Thy1 cDNA ORF Clone, Mouse, C-Myc tag MG50461-CM
    Thy1 cDNA ORF Clone, Mouse, N-Myc tag MG50461-NM
    Thy1 qPCR Primer Pairs, Mouse MP200076

    Thy1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Thy1 cDNA ORF Clone in Cloning Vector, Human HG16897-U
    Thy1 cDNA ORF Clone, Human, untagged HG16897-UT
    Thy1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16897-ACG
    Thy1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16897-ACGLN
    Thy1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16897-ACR
    Thy1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16897-CF
    Thy1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16897-NF
    Thy1 cDNA ORF Clone, Human, C-His tag HG16897-CH
    Thy1 cDNA ORF Clone, Human, N-His tag HG16897-NH
    Thy1 cDNA ORF Clone, Human, C-HA tag HG16897-CY
    Thy1 cDNA ORF Clone, Human, N-HA tag HG16897-NY
    Thy1 cDNA ORF Clone, Human, C-Myc tag HG16897-CM
    Thy1 cDNA ORF Clone, Human, N-Myc tag HG16897-NM
    info info
    添加购物车成功! 添加购物车失败!