Text Size:AAA

쥐 BAFFR / TNFRSF13C / CD268 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat TNFRSF13C cDNA 클론 제품 정보
Gene_bank_ref_id:XM_576316.3
cDNA 크기:528bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 13c with N terminal Flag tag.
유전자 동의어:RGD1560810, Tnfrsf13c
:Rat
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) also known as B-cell-activating factor receptor (BAFFR) and CD268 antigen, is a member of the tumor necrosis factor receptor superfamily. A tumor necrosis factor receptor (TNFR), or death receptor, is a trimeric cytokine receptor that binds tumor necrosis factors (TNF). The receptor cooperates with an adaptor protein which is important in determining the outcome of the response. Members of the TNF receptor superfamily (TNFRSF) have crucial roles in both innate and adaptive immunity and in cellular apoptosis process. Apoptosis is a cell suicide mechanism that enables metazoans to control cell number in tissues and to eliminate individual cells that threaten the animal's survival. Certain cells have unique sensors, termed death receptors or tumour necrosis factor (TNFR), on their surface. Tumour necrosis factors (TNFR) detect the presence of extracellular death signals and, in response, they rapidly ignite the cell's intrinsic apoptosis machinery. It has been proposed that abnormally high levels of BAFFR/TNFRSF13C (CD268) may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells.

참고자료
  • Ashkenazi A, et al. (1998) Death receptors: signaling and modulation. Science. 281(5381): 1305-8.
  • Losi CG, et al. (2005) Mutational analysis of human BAFF receptor TNFRSF13C (BAFF-R) in patients with common variable immunodeficiency. J Clin Immunol. 25(5): 496-502.
  • Hentges KE, et al. (2002) Tnfrsf13c (Baffr) is mis-expressed in tumors with murine leukemia virus insertions at Lvis22. Genomics. 80(2): 204-12.
  • Size / Price
    Cat No: RG80171-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".