After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 BCMA/TNFRSF17/CD269 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat TNFRSF17 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001105761.1
cDNA 크기:555bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 17 with N terminal Flag tag.
유전자 동의어:Tnfrsf17
:Rat
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

Tumor necrosis factor receptor superfamily, member 17 (TNFRSF17), also known as B cell maturation antigen (BCMA) or CD269 antigen, is a member of the TNF-receptor superfamily. This receptor is preferentially expressed in mature B lymphocytes, and may be important for B cell development and autoimmune response. This receptor has been shown to specifically bind to the tumor necrosis factor (ligand) superfamily, member 13b (TNFSF13BBAFF), and to lead to NF-kappaB and MAPK8/JNK activation. TNFRSF17/BCMA/CD269 also binds to various TRAF family members, and thus may transduce signals for cell survival and proliferation. TNFRSF17/BCMA/CD269 is a receptor for TALL-1 and BCMA activates NF-kappaB through a TRAF5-, TRAF6-, NIK-, and IKK-dependent pathway. The identification of TNFRSF17 as a NF-kappaB-activating receptor for TALL-1 suggests molecular targets for drug development against certain immunodeficient or autoimmune diseases. TNFRSF17/BCMA is a target of donor B-cell immunity in patients with myeloma who respond to DLI. Antibody responses to cell-surface BCMA may contribute directly to tumor rejection in vivo.

참고자료
  • Novak AJ, et al. (2004) Expression of BCMA, TACI, and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood. 103 (2): 689–94.
  • O'Connor BP, et al. (2004) BCMA is essential for the survival of long-lived bone marrow plasma cells. J Exp Med. 199(1): 91-8.
  • Moser K, et al. (2006) Stromal niches, plasma cell differentiation and survival. Curr Opin Immunol. 18(3): 265-70.
  • Size / Price
    Cat No: RG80156-NF
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".