After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 TL1A / TNFSF15 Gene ORF cDNA clone expression plasmid, N-Flag 태그

데이터시트리뷰관련제품프로토콜
Rat TNFSF15 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_145765.1
cDNA 크기:759bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus tumor necrosis factor (ligand) superfamily, member 15 with N terminal Flag tag.
유전자 동의어:Tl1, Vegi, Tnfsf15
:Rat
벡터:pCMV3-SP-N-FLAG
Plasmid:
제한 사이트:
태그 씨퀀스:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
연구배경

TL1A, also known as TNFSF15, is a cytokine that belongs to the tumor necrosis factor (TNF) ligand family. It is specifically expressed in endothelial cells. TL1A also can be detected in monocytes, placenta, lung, liver, kidney, skeletal muscle, pancreas, spleen, prostate, small intestine and colon. TL1A is a ligand for receptor TNFRSF25 and decoy receptor TNFRSF21/DR6. It mediates activation of NF-kappa-B. It also inhibits vascular endothelial growth and angiogenesis (in vitro). TL1A promotes activation of caspases and apoptosis. It is also found to inhibit endothelial cell proliferation, and thus may function as an angiogenesis inhibitor.

참고자료
  • Jin T, et al. (2007) X-ray crystal structure of TNF ligand family member TL1A at 2.1A. Biochem Biophys Res Commun. 364(1):1-6.
  • Cassatella MA, et al. (2007) Soluble TNF-like cytokine (TL1A) production by immune complexes stimulated monocytes in rheumatoid arthritis. J Immunol. 178(11):7325-33
  • Prehn JL, et al. (2007) The T cell costimulator TL1A is induced by FcgammaR signaling in human monocytes and dendritic cells. J Immunol. 178(7):4033-8.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".