TPPP3 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80727-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TPPP3 Reagents
CRO Services
Product recommended

All TPPP3 Reagents
TPPP3 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
531 bp
Description
Full length Clone DNA of Rat tubulin polymerization-promoting protein family member 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TPPP3 Background Information

TPPP3, a member of the Tubulin polymerization-promoting protein family, is an intrinsically unstructured protein that induces tubulin polymerization. TPPP3 is a marker in the developing musculoskeletal system. In tendons, Tppp3 is expressed in cells at the circumference of the developing tendons, likely the progenitors of connective tissues that surround tendons: the tendon sheath, epitenon, and paratenon. Tppp3 is also expressed in forming synovial joints. The onset of Tppp3 expression in joints coincides with cavitation, representing a molecular marker that can be used to indicate this stage in joint transition in joint differentiation. In late embryonic stages, Tppp3 expression highlights other demarcation lines that surround differentiating tissues in the forelimb.

Depletion of TPPP3 by microRNA-based RNA interference (RNAi) inhibits cell growth, arrests cell cycles, and causes mitotic abnormalities in HeLa cells. C57BL/6 mice that received subcutaneously injected LLC (Lewis lung carcinoma) cells in which TPPP3 was knocked down showed a pronounced reduction in tumor progression. The migration/invasion activity of TPPP3-knockdown LLC cells was significantly suppressed in a transwell chamber migration assay. When these cells were injected into the tail veins of C57BL/6 mice, they exhibited milder lung metastasis compared with control tumor cells. Taken together, these findings suggested that the TPPP3 gene played an important role in tumorigenesis and metastasis, and it could potentially become a novel target for cancer therapy.

Full Name
tubulin polymerization-promoting protein family member 3
References
  • Staverosky JA, et al. (2009) Tubulin polymerization-promoting protein family member 3, Tppp3, is a specific marker of the differentiating tendon sheath and synovial joints. Dev Dyn. 238(3):685-92.
  • Zhou W, et al. (2010) Stable knockdown of TPPP3 by RNA interference in Lewis lung carcinoma cell inhibits tumor growth and metastasis. Mol Cell Biochem. 343(1-2):231-8.
  • TPPP3 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    TPPP3 cDNA ORF Clone in Cloning Vector, Canine DG70233-U
    TPPP3 cDNA ORF Clone, Canine, untagged DG70233-UT
    TPPP3 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70233-ACGLN
    TPPP3 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70233-ACG
    TPPP3 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70233-ANG
    TPPP3 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70233-ACR
    TPPP3 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70233-ANR
    TPPP3 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70233-CF
    TPPP3 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70233-NF
    TPPP3 cDNA ORF Clone, Canine, C-His tag DG70233-CH
    TPPP3 cDNA ORF Clone, Canine, N-His tag DG70233-NH
    TPPP3 cDNA ORF Clone, Canine, C-HA tag DG70233-CY
    TPPP3 cDNA ORF Clone, Canine, N-HA tag DG70233-NY
    TPPP3 cDNA ORF Clone, Canine, C-Myc tag DG70233-CM
    TPPP3 cDNA ORF Clone, Canine, N-Myc tag DG70233-NM

    TPPP3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TPPP3 cDNA ORF Clone in Cloning Vector, Rat RG80727-U
    TPPP3 cDNA ORF Clone, Rat, untagged RG80727-UT
    TPPP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80727-ACG
    TPPP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80727-ACGLN
    TPPP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80727-ANG
    TPPP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80727-ACR
    TPPP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80727-ANR
    TPPP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80727-CF
    TPPP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80727-NF
    TPPP3 cDNA ORF Clone, Rat, C-His tag RG80727-CH
    TPPP3 cDNA ORF Clone, Rat, N-His tag RG80727-NH
    TPPP3 cDNA ORF Clone, Rat, C-HA tag RG80727-CY
    TPPP3 cDNA ORF Clone, Rat, N-HA tag RG80727-NY
    TPPP3 cDNA ORF Clone, Rat, C-Myc tag RG80727-CM
    TPPP3 qPCR Primer Pairs, Rat RP300691

    TPPP3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TPPP3 cDNA ORF Clone in Cloning Vector, Human HG14360-G
    TPPP3 cDNA ORF Clone, Human, untagged HG14360-UT
    TPPP3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14360-ACG
    TPPP3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14360-ACGLN
    TPPP3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14360-ANG
    TPPP3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14360-ACR
    TPPP3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14360-ANR
    TPPP3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14360-CF
    TPPP3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14360-NF
    TPPP3 cDNA ORF Clone, Human, C-His tag HG14360-CH
    TPPP3 cDNA ORF Clone, Human, N-His tag HG14360-NH
    TPPP3 cDNA ORF Clone, Human, C-HA tag HG14360-CY
    TPPP3 cDNA ORF Clone, Human, N-HA tag HG14360-NY
    TPPP3 cDNA ORF Clone, Human, C-Myc tag HG14360-CM
    TPPP3 cDNA ORF Clone, Human, N-Myc tag HG14360-NM
    TPPP3 qPCR Primer Pairs, Human HP103009
    info info
    添加购物车成功! 添加购物车失败!