After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Text Size:AAA

쥐 TSPAN31 Gene ORF cDNA clone expression plasmid, C-Myc 태그

데이터시트리뷰관련제품프로토콜
Rat TSPAN31 cDNA 클론 제품 정보
Gene_bank_ref_id:NM_001008378.1
cDNA 크기:633bp
cDNA 설명:Full length Clone DNA of Rattus norvegicus tetraspanin 31 with C terminal Myc tag.
유전자 동의어:Sas
:Rat
벡터:pCMV3-C-Myc
Plasmid:
제한 사이트:
태그 씨퀀스:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
염기서열 설명:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
보관:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
연구배경

TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

참고자료
  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Cat No: RG81110-CM
    정가: 
    가격:      (You Save: )
    크기:
    수량:+-
    재고정보2-3 weeks
    대량 주문 문의장바구니에 추가
    Contact Us
    이미지
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        주의 : 모든 제품은 "연구 목적만을 위한 것이며 진단이나 치료에 사용하도록 의도되지 않았습니다".