TM4SF2 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80372-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TM4SF2 Reagents
CRO Services
Product recommended

All TM4SF2 Reagents
TM4SF2 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Rat tetraspanin 7 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TM4SF2 Background Information

TALLA-1, also known as TSPAN7, is a member of the transmembrane 4 superfamily Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. TALLA-1 gene is associated with X-linked mental retardation and neuropsychiatric diseases such as Huntington's chorea, fragile X syndrome and myotonic dystrophy. TALLA-1 is a cell surface glycoprotein and may have a role in the control of neurite outgrowth. It is known to complex with integrins.

Full Name
tetraspanin 7
References
  • Berditchevski F. 2002, J Cell Sci. 114 (23): 4143-51.
  • Castellví-Bel S. et al., 2001, Mol Genet Metab. 72 (2): 104-8.
  • Abidi FE. et al., 2002, J Med Genet. 39 (6): 430-3.
  • TM4SF2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    TM4SF2 cDNA ORF Clone in Cloning Vector, Rhesus CG90243-G
    TM4SF2 cDNA ORF Clone, Rhesus, untagged CG90243-UT
    TM4SF2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90243-ACGLN
    TM4SF2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90243-ACG
    TM4SF2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90243-ACR
    TM4SF2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90243-CF
    TM4SF2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90243-NF
    TM4SF2 cDNA ORF Clone, Rhesus, C-His tag CG90243-CH
    TM4SF2 cDNA ORF Clone, Rhesus, N-His tag CG90243-NH
    TM4SF2 cDNA ORF Clone, Rhesus, C-HA tag CG90243-CY
    TM4SF2 cDNA ORF Clone, Rhesus, N-HA tag CG90243-NY
    TM4SF2 cDNA ORF Clone, Rhesus, C-Myc tag CG90243-CM
    TM4SF2 cDNA ORF Clone, Rhesus, N-Myc tag CG90243-NM

    TM4SF2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    TM4SF2 cDNA ORF Clone in Cloning Vector, Rat RG80372-G
    TM4SF2 cDNA ORF Clone, Rat, untagged RG80372-UT
    TM4SF2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80372-ACGLN
    TM4SF2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80372-ACG
    TM4SF2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80372-ACR
    TM4SF2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80372-CF
    TM4SF2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80372-NF
    TM4SF2 cDNA ORF Clone, Rat, C-His tag RG80372-CH
    TM4SF2 cDNA ORF Clone, Rat, N-His tag RG80372-NH
    TM4SF2 cDNA ORF Clone, Rat, N-HA tag RG80372-NY
    TM4SF2 cDNA ORF Clone, Rat, C-Myc tag RG80372-CM
    TM4SF2 cDNA ORF Clone, Rat, N-Myc tag RG80372-NM
    TM4SF2 qPCR Primer Pairs, Rat RP300394

    TM4SF2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TM4SF2 cDNA ORF Clone in Cloning Vector, Mouse MG50879-G
    TM4SF2 cDNA ORF Clone, Mouse, untagged MG50879-UT
    TM4SF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50879-ACG
    TM4SF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50879-ACGLN
    TM4SF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50879-ACR
    TM4SF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50879-CF
    TM4SF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50879-NF
    TM4SF2 cDNA ORF Clone, Mouse, C-His tag MG50879-CH
    TM4SF2 cDNA ORF Clone, Mouse, N-His tag MG50879-NH
    TM4SF2 cDNA ORF Clone, Mouse, C-HA tag MG50879-CY
    TM4SF2 cDNA ORF Clone, Mouse, N-HA tag MG50879-NY
    TM4SF2 cDNA ORF Clone, Mouse, C-Myc tag MG50879-CM
    TM4SF2 cDNA ORF Clone, Mouse, N-Myc tag MG50879-NM
    TM4SF2 qPCR Primer Pairs, Mouse MP200850

    TM4SF2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TM4SF2 cDNA ORF Clone in Cloning Vector, Human HG14031-G
    TM4SF2 cDNA ORF Clone, Human, untagged HG14031-UT
    TM4SF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14031-ACG
    TM4SF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14031-ACGLN
    TM4SF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14031-ACR
    TM4SF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14031-CF
    TM4SF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14031-NF
    TM4SF2 cDNA ORF Clone, Human, C-His tag HG14031-CH
    TM4SF2 cDNA ORF Clone, Human, N-His tag HG14031-NH
    TM4SF2 cDNA ORF Clone, Human, C-HA tag HG14031-CY
    TM4SF2 cDNA ORF Clone, Human, N-HA tag HG14031-NY
    TM4SF2 cDNA ORF Clone, Human, C-Myc tag HG14031-CM
    TM4SF2 cDNA ORF Clone, Human, N-Myc tag HG14031-NM
    TM4SF2 qPCR Primer Pairs, Human HP102687
    info info
    添加购物车成功! 添加购物车失败!