TTC33 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80489-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TTC33 Reagents
CRO Services
Product recommended

All TTC33 Reagents
TTC33 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of Rat tetratricopeptide repeat domain 33 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TTC33 Background Information
Full Name
tetratricopeptide repeat domain 33

TTC33 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TTC33 cDNA ORF Clone in Cloning Vector, Rat RG80489-U
TTC33 cDNA ORF Clone, Rat, untagged RG80489-UT
TTC33 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80489-ACGLN
TTC33 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80489-ACG
TTC33 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80489-ANG
TTC33 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80489-ACR
TTC33 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80489-ANR
TTC33 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80489-CF
TTC33 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80489-NF
TTC33 cDNA ORF Clone, Rat, C-His tag RG80489-CH
TTC33 cDNA ORF Clone, Rat, N-His tag RG80489-NH
TTC33 cDNA ORF Clone, Rat, C-HA tag RG80489-CY
TTC33 cDNA ORF Clone, Rat, C-Myc tag RG80489-CM
TTC33 cDNA ORF Clone, Rat, N-Myc tag RG80489-NM
TTC33 qPCR Primer Pairs, Rat RP300453

TTC33 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TTC33 cDNA ORF Clone in Cloning Vector, Mouse MG52371-G
TTC33 cDNA ORF Clone, Mouse, untagged MG52371-UT
TTC33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52371-ACG
TTC33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52371-ACGLN
TTC33 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52371-ANG
TTC33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52371-ACR
TTC33 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52371-ANR
TTC33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52371-CF
TTC33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52371-NF
TTC33 cDNA ORF Clone, Mouse, C-His tag MG52371-CH
TTC33 cDNA ORF Clone, Mouse, N-His tag MG52371-NH
TTC33 cDNA ORF Clone, Mouse, C-HA tag MG52371-CY
TTC33 cDNA ORF Clone, Mouse, N-HA tag MG52371-NY
TTC33 cDNA ORF Clone, Mouse, C-Myc tag MG52371-CM
TTC33 cDNA ORF Clone, Mouse, N-Myc tag MG52371-NM
TTC33 qPCR Primer Pairs, Mouse MP202244

TTC33 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TTC33 cDNA ORF Clone in Cloning Vector, Human HG27211-U
TTC33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG27211-ACGLN
info info
添加购物车成功! 添加购物车失败!